ID: 910676504

View in Genome Browser
Species Human (GRCh38)
Location 1:89821397-89821419
Sequence GCCCGAGCTGCGGTTGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910676496_910676504 9 Left 910676496 1:89821365-89821387 CCGGAGCGCGCAACCCTGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 156
910676493_910676504 19 Left 910676493 1:89821355-89821377 CCGCGCCGAGCCGGAGCGCGCAA 0: 1
1: 0
2: 0
3: 4
4: 34
Right 910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 156
910676500_910676504 -5 Left 910676500 1:89821379-89821401 CCTGGCGCAGGCGCCGCGGCCCG 0: 1
1: 0
2: 3
3: 48
4: 490
Right 910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 156
910676494_910676504 14 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 156
910676499_910676504 -4 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910676504 Original CRISPR GCCCGAGCTGCGGTTGCGGC CGG Intronic
901934389 1:12617644-12617666 GCCCCAGCAGCCGTTTCGGCTGG + Exonic
903750211 1:25616798-25616820 GCCCGAGCGGCGGCGGCGGCGGG + Intergenic
904652163 1:32013921-32013943 GCCCGAGCGGCGGTTGGCGGGGG - Exonic
905440040 1:37989838-37989860 GCCTGAGCAGAGGCTGCGGCAGG - Intronic
907409541 1:54274641-54274663 GCCCGAGCAGGAGTGGCGGCTGG - Intronic
910427526 1:87131940-87131962 GCCCGAGGCGCGGTCGCAGCCGG + Intronic
910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG + Intronic
910864716 1:91777577-91777599 GCTAGAGCTGGGGTTGGGGCTGG - Intronic
912993501 1:114511151-114511173 GCTCTTGCTGCGGCTGCGGCTGG - Exonic
914242089 1:145859011-145859033 GCCTGAGCTCCGGCTCCGGCTGG - Exonic
915355995 1:155255433-155255455 CCCCGAGCTCCGGCTGCCGCAGG + Intronic
917111912 1:171557450-171557472 ACCGGAGCTGAGGTTGAGGCTGG - Exonic
921390366 1:214608538-214608560 GCAGGAGACGCGGTTGCGGCGGG + Intronic
922832254 1:228609819-228609841 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922832814 1:228612060-228612082 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922833375 1:228614301-228614323 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922833935 1:228616542-228616564 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922834492 1:228618783-228618805 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922835046 1:228620998-228621020 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922835603 1:228623218-228623240 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922836161 1:228625460-228625482 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922836719 1:228627699-228627721 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922837278 1:228629941-228629963 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922837839 1:228632182-228632204 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922838397 1:228634422-228634444 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922838955 1:228636647-228636669 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922839515 1:228638888-228638910 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922840076 1:228641119-228641141 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922840636 1:228643360-228643382 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
922841199 1:228645591-228645613 ACCCCGGCTGCGGCTGCGGCGGG + Intergenic
1062767023 10:73928-73950 GCCCGCGCTGCGAGTGCAGCGGG - Intergenic
1065189369 10:23196177-23196199 GCCCGAGCTGCGCTGGGTGCAGG + Intergenic
1065660295 10:27998965-27998987 GACTGGGCTGCGGTCGCGGCCGG - Intronic
1069622472 10:69846365-69846387 ACCCGAGCTGGGGTTGGGGTTGG + Intronic
1076691415 10:132225500-132225522 GCCCGAGCTGGGGTTCCAGATGG - Intronic
1077414859 11:2420258-2420280 GACGGAGCTGCGGCTGAGGCTGG - Exonic
1078091676 11:8268200-8268222 GCCCGGGCTTCGGCGGCGGCGGG - Intronic
1083816333 11:65134414-65134436 GCCCGAGTTGTGGTTGGGGTCGG - Intronic
1084009843 11:66341293-66341315 GAGTCAGCTGCGGTTGCGGCTGG - Exonic
1084889763 11:72230904-72230926 GCCCGGGCTGGGGCTGGGGCGGG + Intronic
1089255169 11:117190309-117190331 GCTGGAGCTGAGGCTGCGGCAGG - Intronic
1094624171 12:32107010-32107032 GCCCGGGCTGCGGCGGCCGCGGG - Intronic
1098286362 12:68911351-68911373 GCCCAAACTGCAGCTGCGGCTGG + Intronic
1101592955 12:106139375-106139397 GCCGGGGCGGCGGTTGCGGCTGG + Exonic
1105217894 13:18300131-18300153 GCCCGAGGTGGGGTTGGGGGGGG - Intergenic
1105943643 13:25171587-25171609 GCCGGAGCCGCGGCGGCGGCGGG - Exonic
1106125582 13:26897880-26897902 GCCAGAGCTGGGGCTGGGGCTGG + Intergenic
1118632908 14:67722580-67722602 GCCAGAGCTGGGGTTGAAGCTGG + Exonic
1120993340 14:90397482-90397504 ACCCCCGCTGCAGTTGCGGCCGG - Intronic
1120993812 14:90399715-90399737 GCACCAGCTGCAGTGGCGGCAGG - Intronic
1121733863 14:96204830-96204852 GCCAGAGCTGGAGTGGCGGCGGG - Exonic
1122505468 14:102229118-102229140 GCGCGGGCCGCGGGTGCGGCAGG + Exonic
1202853731 14_GL000225v1_random:37279-37301 GTCCGTGGTGGGGTTGCGGCCGG + Intergenic
1124469299 15:29968890-29968912 GCCGCAGCTGCGGGTGCGGCGGG - Intergenic
1129394794 15:75237848-75237870 GCCCAAGCTCCGGTGGAGGCGGG + Intergenic
1131180170 15:90233975-90233997 GCCCCAGGAGCGGTTGCCGCGGG - Exonic
1132368503 15:101276540-101276562 GACCGAGCTGCGGCTGCTGTGGG - Exonic
1132398274 15:101489693-101489715 GCCCGAGCTGCGAGTGCGCCGGG + Exonic
1132546271 16:534798-534820 GCCCGAGCTGGGGGTGTGGGGGG - Intronic
1132658505 16:1051371-1051393 GCCCGAGCTGAGGTTGCACAGGG - Intergenic
1132987726 16:2776822-2776844 GCGCGAGCTGCGCTCGCCGCGGG - Intronic
1133417408 16:5617030-5617052 GTCCCAGCTGCGGTTGCTGAGGG + Intergenic
1134539935 16:15056037-15056059 GCCCGAGGGGCGGGGGCGGCGGG - Exonic
1135491713 16:22915153-22915175 GCCCAGGGTGCGGTTGCGGAAGG - Exonic
1139576915 16:67847470-67847492 GCCCAAGCCCCGGCTGCGGCAGG - Intronic
1139673308 16:68506346-68506368 GCCCCAGCTGAGGTTCAGGCGGG - Intergenic
1139911331 16:70399247-70399269 GCCCCAGCTGCAGTTGCGTAGGG + Exonic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141362209 16:83406209-83406231 GACTGAGCTGCGGTAGCGCCCGG + Intronic
1141445310 16:84054366-84054388 AGCCGAGCTGTGGTGGCGGCTGG - Exonic
1142336161 16:89490570-89490592 GACCCAGCGGCGGCTGCGGCGGG + Intergenic
1142586850 17:979420-979442 GCCCGAGCCGCGGCGGCGCCTGG - Exonic
1143443951 17:6996308-6996330 GGCCGAGCTGGGCTCGCGGCGGG + Intronic
1146197314 17:30824606-30824628 GCCTGAGCTGCTGTTGCAGGAGG - Exonic
1147312966 17:39605907-39605929 GCCCGAGCCGTGGAAGCGGCCGG + Exonic
1147723892 17:42554734-42554756 GCCCCTGCTGCGGATGCGCCTGG + Exonic
1151597019 17:75084479-75084501 CCCTGAGCTGCGGTGGGGGCAGG - Intergenic
1151670750 17:75570504-75570526 GCCTGAGGTGAGGCTGCGGCCGG + Intronic
1152544000 17:80991844-80991866 ACCCGAGCTACGGTGGCCGCGGG + Exonic
1152643448 17:81458454-81458476 GCCAGTGCTGCGGGTGAGGCTGG + Exonic
1154294580 18:13137342-13137364 GCGCGAGCTGTGGGGGCGGCCGG + Intergenic
1154940789 18:21111368-21111390 GCCCGAGCGGCGGCCGCAGCTGG - Exonic
1157755873 18:50217420-50217442 GCCAGAGCTGGGGTGGTGGCCGG + Intergenic
1158643392 18:59221284-59221306 GGCCGCGCTGCGGGTGCGGAGGG + Intronic
1160703471 19:518641-518663 GCCCGGGCTGGGGATGCTGCGGG + Intronic
1160939666 19:1614386-1614408 GCCCGAGCACCGGGAGCGGCTGG - Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161990687 19:7682394-7682416 GGCCGAGCTGCAGTCGCGCCTGG + Exonic
1162872985 19:13599918-13599940 CCCCGAGCTGCGGTTGTGCAGGG + Intronic
1166098138 19:40554430-40554452 GCCCGAGCTGGGGGTGCGGAGGG + Intronic
1167001199 19:46746507-46746529 GCGCGCGCGGTGGTTGCGGCGGG - Exonic
1168098674 19:54129315-54129337 GCCCGAGGAGCGGTCGCGGATGG - Exonic
927295569 2:21449224-21449246 GCCAGAGCTGCATTTGCAGCAGG - Intergenic
934845234 2:97658072-97658094 CCCCGAGCTGCTGTTCCAGCCGG - Exonic
935592764 2:104856353-104856375 GCGCGTGGTGCGGGTGCGGCGGG - Exonic
938502081 2:131835612-131835634 GCCCGAGCAGCAGGTGGGGCTGG - Intergenic
944187660 2:196967306-196967328 GCAGGAGCTGCGGTTGGGGAAGG - Intronic
946354876 2:219178327-219178349 GCTCGGGCGGCGGCTGCGGCGGG + Exonic
948479168 2:238239672-238239694 GCAGGAGCTGCGGCTGCTGCTGG - Exonic
948940366 2:241192401-241192423 GCCCGAGGTGAGGGTGAGGCAGG + Intronic
1170150522 20:13221791-13221813 GGCCGAGCTGCTGCTGCTGCTGG + Exonic
1172274930 20:33674262-33674284 GCGCGAGCTGGGGGTGCCGCGGG + Exonic
1172618678 20:36306333-36306355 GCCCCAGATGCGGCTGCGGGAGG - Exonic
1172764824 20:37345917-37345939 GCCCGAGCTGGGGGTCCGGGCGG - Intronic
1174338853 20:49883578-49883600 GCCCCAGATGCGGGTGCGGGAGG - Intronic
1175429526 20:58891679-58891701 GGCCGGGCTGCGGCGGCGGCGGG - Intronic
1175721219 20:61288604-61288626 GCCAGAGCTGCGGTTACCACGGG + Intronic
1179947221 21:44686519-44686541 GCCCGACCTGAGCATGCGGCAGG - Intronic
1179976840 21:44873305-44873327 GCGGGAGCTGCCGTCGCGGCTGG - Intronic
1183406523 22:37633046-37633068 ACCCCAGCTGGGGTTGGGGCTGG - Exonic
1184004753 22:41699866-41699888 GCCCGAGAGGCCGCTGCGGCCGG - Intronic
1184594479 22:45505453-45505475 GCCAGAGCTGTGGGTGCTGCAGG - Intronic
949918796 3:8985594-8985616 GCCCGAGCTGCTGCTGCTGCTGG + Exonic
953024534 3:39137285-39137307 GACCCAGCTGCGGCTGCTGCAGG + Exonic
953352952 3:42229816-42229838 GCCAGAGCTGCGGGGGAGGCTGG - Intergenic
968123521 3:196142530-196142552 GCCAGAGCTGCAGTTGCTGTTGG - Intergenic
968583733 4:1406451-1406473 GCCCGAGCCGCCGGAGCGGCGGG - Intergenic
968809351 4:2793035-2793057 GACGGAGCTGCGGCGGCGGCGGG + Intronic
969715872 4:8867847-8867869 GGCCCAGCGGCGGCTGCGGCCGG + Exonic
971279992 4:25234577-25234599 GCCCGCGGTGCGGCTGCGGCTGG - Intronic
971327429 4:25655736-25655758 GCCCCGGCGGCGGCTGCGGCAGG + Intronic
975965206 4:79964879-79964901 GCCCGGGCTTTGATTGCGGCGGG - Intronic
976390017 4:84497706-84497728 GCCCGGGCGGCGGCGGCGGCGGG + Exonic
980043617 4:127965494-127965516 ACCGGAGCTGCGATTGGGGCTGG + Exonic
981920397 4:150079119-150079141 GCCCGAGCTGCTGCTGCCCCCGG - Exonic
984756870 4:183332713-183332735 GCTCGACCTGGGGCTGCGGCAGG + Intergenic
986422249 5:7597237-7597259 GCCAGGGCTGCGGTTTGGGCTGG + Intronic
990718517 5:58666703-58666725 GCCTGAGCTGCGGTCAGGGCAGG + Intronic
999386557 5:151157766-151157788 CCCCGCGCTGCGGTTGCTGCTGG - Exonic
1001984285 5:176060898-176060920 GCACGAGCAGCGGTGGGGGCGGG + Intronic
1002060025 5:176620587-176620609 GCCAGGGTTGCGGTCGCGGCTGG - Exonic
1002233191 5:177783167-177783189 GCACGAGCAGCGGTGGGGGCGGG - Intronic
1002262788 5:178006614-178006636 GCACGAGCAGCGGTGGGGGCGGG + Intronic
1005470264 6:26156406-26156428 GCCGGAGCAGCGGGCGCGGCAGG - Exonic
1010271999 6:73925818-73925840 CTCCCAGCCGCGGTTGCGGCAGG + Intergenic
1012251985 6:96990745-96990767 GCCCAAGCTGGGGTGGGGGCGGG + Intronic
1013207590 6:107958464-107958486 GCCGGAGCAGCGGTCGCGGGCGG + Intergenic
1018929666 6:168232696-168232718 CCCGGAGCTGCCTTTGCGGCTGG - Intergenic
1019496097 7:1341319-1341341 GCCCCAGCTGCAGTGGGGGCAGG + Intergenic
1019521882 7:1464405-1464427 GCCGGTGCTGCGGCTGGGGCTGG + Intergenic
1021452774 7:20798054-20798076 GCCCGGGCTGCGGCGGCCGCGGG + Intergenic
1022723027 7:32957597-32957619 GCAGGAGCAGCGGTGGCGGCGGG - Exonic
1024255523 7:47537415-47537437 CTCGGAGCTGCGGTTGGGGCGGG - Intronic
1026047976 7:66921248-66921270 GCCCGAACTGAGGCGGCGGCGGG + Exonic
1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG + Exonic
1029543478 7:101198306-101198328 GCCCGAGCTGGGGCTGGGACAGG + Exonic
1032074647 7:128830611-128830633 GCGCGGGCTGGGGGTGCGGCCGG - Exonic
1035159893 7:156942946-156942968 GCCCCAGCTGAAGGTGCGGCGGG + Intergenic
1035303966 7:157917859-157917881 GGCCGAGCTGGGGCTGGGGCTGG + Intronic
1038450057 8:27634028-27634050 GCGCGGGCTGCGGAGGCGGCGGG - Intronic
1040688719 8:49909805-49909827 TCGCGAGCCGCGGTGGCGGCTGG + Intronic
1041502474 8:58553552-58553574 GCCCGGGCTGGGGCTGGGGCTGG + Intronic
1049651303 8:143771207-143771229 TCCCGAGCTGCGGGCTCGGCGGG + Intergenic
1056078196 9:83062735-83062757 CACGGAGCTGCGGGTGCGGCCGG - Exonic
1056558112 9:87706611-87706633 GGCCGAGCTGCTGGTGCTGCTGG + Exonic
1059102595 9:111484250-111484272 GCCCGGGCTGCCCTAGCGGCCGG + Exonic
1061405486 9:130391207-130391229 GCCCGAGCTCCGGATCCGGGGGG - Intronic
1061480495 9:130895653-130895675 GCCTGAGCTGGGGTTCCTGCTGG + Intergenic
1061820860 9:133226525-133226547 GCCCTAGCTGCGGCTCTGGCAGG - Intergenic
1061940201 9:133879842-133879864 GCCAGAGCTTCGTCTGCGGCCGG - Intronic
1062161062 9:135080193-135080215 GCCCAAGCTTAGGTTGCAGCAGG - Intronic
1062220210 9:135410997-135411019 GCCCGGGCTGCAGCTGCGGCAGG + Intergenic
1062332239 9:136049887-136049909 GCGGGGGCTGCGGTGGCGGCGGG - Exonic
1062497363 9:136838067-136838089 GCCCGAGCAGCAGGTGGGGCTGG + Intronic
1192274606 X:69616373-69616395 GCCAGGGCTGCGGGTGTGGCGGG + Exonic
1198388139 X:136147717-136147739 CCCCGAGCGGCGGCGGCGGCGGG - Intronic
1199699483 X:150365012-150365034 CCCAGAGCTGCGGTGGCGGCCGG - Intronic
1199996447 X:153029499-153029521 GCAGGAGCTGCGGGTGAGGCAGG + Intergenic