ID: 910676506

View in Genome Browser
Species Human (GRCh38)
Location 1:89821398-89821420
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910676500_910676506 -4 Left 910676500 1:89821379-89821401 CCTGGCGCAGGCGCCGCGGCCCG 0: 1
1: 0
2: 3
3: 48
4: 490
Right 910676506 1:89821398-89821420 CCCGAGCTGCGGTTGCGGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 125
910676493_910676506 20 Left 910676493 1:89821355-89821377 CCGCGCCGAGCCGGAGCGCGCAA 0: 1
1: 0
2: 0
3: 4
4: 34
Right 910676506 1:89821398-89821420 CCCGAGCTGCGGTTGCGGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 125
910676499_910676506 -3 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676506 1:89821398-89821420 CCCGAGCTGCGGTTGCGGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 125
910676494_910676506 15 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676506 1:89821398-89821420 CCCGAGCTGCGGTTGCGGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 125
910676496_910676506 10 Left 910676496 1:89821365-89821387 CCGGAGCGCGCAACCCTGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 910676506 1:89821398-89821420 CCCGAGCTGCGGTTGCGGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type