ID: 910676508

View in Genome Browser
Species Human (GRCh38)
Location 1:89821409-89821431
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910676502_910676508 -6 Left 910676502 1:89821392-89821414 CCGCGGCCCGAGCTGCGGTTGCG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 910676508 1:89821409-89821431 GTTGCGGCCGGGAACTCATTCGG 0: 1
1: 0
2: 0
3: 0
4: 17
910676500_910676508 7 Left 910676500 1:89821379-89821401 CCTGGCGCAGGCGCCGCGGCCCG 0: 1
1: 0
2: 3
3: 48
4: 490
Right 910676508 1:89821409-89821431 GTTGCGGCCGGGAACTCATTCGG 0: 1
1: 0
2: 0
3: 0
4: 17
910676494_910676508 26 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676508 1:89821409-89821431 GTTGCGGCCGGGAACTCATTCGG 0: 1
1: 0
2: 0
3: 0
4: 17
910676499_910676508 8 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676508 1:89821409-89821431 GTTGCGGCCGGGAACTCATTCGG 0: 1
1: 0
2: 0
3: 0
4: 17
910676496_910676508 21 Left 910676496 1:89821365-89821387 CCGGAGCGCGCAACCCTGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 910676508 1:89821409-89821431 GTTGCGGCCGGGAACTCATTCGG 0: 1
1: 0
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type