ID: 910679494

View in Genome Browser
Species Human (GRCh38)
Location 1:89847890-89847912
Sequence CTGCATGTATATATGAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910679491_910679494 -3 Left 910679491 1:89847870-89847892 CCTGTATTTGTAAAATAGCACTG 0: 1
1: 0
2: 0
3: 16
4: 209
Right 910679494 1:89847890-89847912 CTGCATGTATATATGAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910679494 Original CRISPR CTGCATGTATATATGAGGTA GGG Intronic
No off target data available for this crispr