ID: 910680977

View in Genome Browser
Species Human (GRCh38)
Location 1:89864113-89864135
Sequence TTTGATCCTCACTATTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910680977 Original CRISPR TTTGATCCTCACTATTGACA TGG (reversed) Intronic
901847389 1:11992040-11992062 TTTGGTCCTCTTTATTAACATGG - Intronic
902529996 1:17084898-17084920 TATGATCCTCACTTTTCAGATGG + Intronic
903005506 1:20295588-20295610 TTTGATCCTCAGTGTGGTCATGG - Intronic
907788151 1:57634475-57634497 TTTGGTGCTTACTATTGCCAAGG - Intronic
908856221 1:68432769-68432791 TTGGATCCTCCCTACTAACAAGG - Intronic
910680977 1:89864113-89864135 TTTGATCCTCACTATTGACATGG - Intronic
914934507 1:151966602-151966624 TTTGACCCTCCCTGATGACAAGG - Intergenic
918006000 1:180542775-180542797 TTTCATCCTCCCTATTCCCAGGG - Intergenic
918618345 1:186574081-186574103 TTTAATTCTCAGTCTTGACATGG - Intergenic
920268671 1:204746213-204746235 TTTGATCCACACTGGGGACAGGG + Intergenic
921266529 1:213425160-213425182 TTTGTTCCTCTCTATTGTTAAGG - Intergenic
921618325 1:217298019-217298041 TATAATCCCCACTAATGACATGG - Intergenic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1065592121 10:27274220-27274242 TTTGATGCTAACCATTTACAAGG + Intergenic
1065619216 10:27562217-27562239 TTTGTTCTTCAATATTGAGAAGG + Intergenic
1065658235 10:27976138-27976160 TTTGATGCTAACCATTTACAAGG - Intronic
1067404208 10:46006063-46006085 TTTGGTAATCACTATTGACCAGG + Intronic
1067807496 10:49403344-49403366 CTTAAACCTCCCTATTGACAAGG + Intergenic
1068745081 10:60520801-60520823 TTTGATTTTCACTTTTGCCAAGG - Intronic
1078120720 11:8506207-8506229 TCTGATCTTCACTATTTAAAAGG - Intronic
1079425336 11:20336016-20336038 TTCGATCACCACTATTGGCATGG - Intergenic
1080492668 11:32783292-32783314 TTCTATCTTCACTGTTGACATGG - Intronic
1082163507 11:48912003-48912025 GTTGAACCTCACTTTTGATAGGG - Intergenic
1089653354 11:119929700-119929722 TTTGATCCTCCCTACTGATGGGG + Intergenic
1094456036 12:30634110-30634132 ATTCATCCACACTATTGTCAAGG + Exonic
1095117212 12:38369001-38369023 TTTGATTTTCACTATTCAAAGGG - Intergenic
1100042241 12:90334158-90334180 TTTGAACTTCAATTTTGACATGG + Intergenic
1102074803 12:110051328-110051350 TTTGATCCTCACAATTCATGAGG - Intronic
1102182880 12:110925416-110925438 TTTGAGCCCCACTATGTACAGGG + Intergenic
1104666739 12:130652978-130653000 TGTGATCCTCACTGTTGGGAAGG - Intronic
1108296531 13:49025291-49025313 TTTTCTCATCACTATTGACTTGG + Intronic
1111224760 13:85254644-85254666 TAAGAACCTCACTATTGACAAGG - Intergenic
1111362543 13:87193810-87193832 TTTGATCCTCATTTTTCACATGG - Intergenic
1113423803 13:110191048-110191070 TTTGATCCCCACTACAGTCAGGG + Intronic
1114425923 14:22622450-22622472 TTTGATCCCCAATGTTGAGATGG - Intergenic
1116380210 14:44258349-44258371 TTTGGTGATCCCTATTGACAGGG - Intergenic
1117914786 14:60665999-60666021 CTTGATCCTCACTTGTGAGATGG + Intergenic
1118537775 14:66788302-66788324 TTTGATCCTCTTTTTTGAGACGG - Intronic
1120453361 14:84699819-84699841 TTTGATGGTCATTCTTGACAAGG - Intergenic
1126974465 15:54159181-54159203 TTTCATGCTCACTATTGAGCAGG + Intronic
1127047054 15:55036956-55036978 TTTGATTCTCAGGATTGACCAGG - Intergenic
1128749214 15:70136845-70136867 TTGCATCCTTACTATTGGCAAGG + Intergenic
1129009964 15:72406978-72407000 TTTGATCCTCGCTATACATATGG + Intronic
1130919636 15:88333486-88333508 TTTAATCATCACTTTTGGCAGGG - Intergenic
1131186925 15:90282376-90282398 TTTGATCCTCACAACTGCCCTGG + Intronic
1134264456 16:12681340-12681362 TTTCCTCCTCACTCTTGCCAGGG + Intronic
1134408747 16:13985532-13985554 GTTTATCCTCAATACTGACAAGG - Intergenic
1136586855 16:31191940-31191962 TTTGAGCCTCACCATTAAAAGGG - Exonic
1139276961 16:65736728-65736750 TTTCATCCTCACAATAAACAGGG + Intergenic
1141045634 16:80713906-80713928 TTTGATCCTGGCTCTTGACTGGG - Intronic
1143394614 17:6582714-6582736 TTTGCTCTTCTCTATTGACTTGG + Intronic
1148800717 17:50223671-50223693 TGTGATCCTCAAAATTTACAAGG - Intergenic
1149998906 17:61419899-61419921 TGTGATCCTCACTCCTGGCATGG - Intergenic
1163028528 19:14528624-14528646 TTTGCTCCGCCCTATGGACAGGG - Intronic
1165216364 19:34276351-34276373 TTTGATCATCAGTTTTGGCAAGG + Intronic
1166610430 19:44188638-44188660 GTTGTTCCTCAGTATTCACAGGG - Intergenic
1167311047 19:48738272-48738294 TTTGATACTGAATATTGACAAGG - Intronic
1168357987 19:55713998-55714020 CTAGATTCTCAGTATTGACATGG - Intronic
926486656 2:13470027-13470049 TTTGATCCTCACTTTTTCAATGG + Intergenic
928402192 2:30987226-30987248 TGTGATCTTCACTGTTGAGATGG - Intronic
929869506 2:45746377-45746399 TCTGGTCCTCACTGTTGAGAAGG + Intronic
933175988 2:79173640-79173662 TTGGATCTTGACTATGGACATGG - Intergenic
935430987 2:102975491-102975513 TTTCTTCCTCACCATTGGCATGG + Intergenic
935931933 2:108136078-108136100 TTTTATCCACACTATTGCCAGGG + Intergenic
940623058 2:156138544-156138566 TTAGCTGCTCAATATTGACATGG + Intergenic
942413676 2:175736672-175736694 GTTGGGTCTCACTATTGACAAGG - Intergenic
943144288 2:184022063-184022085 TTTGAACCACACTATTAAGATGG - Intergenic
943713631 2:191125783-191125805 CTGGATCCTCATTATTGAAAGGG + Intronic
948630882 2:239301898-239301920 CTTGCTCCTCACTACTGCCAAGG + Intronic
1177308858 21:19359934-19359956 TTTGTTCCTCAGTTTTGCCATGG - Intergenic
1177520912 21:22224177-22224199 TTTGATCGTCTCAATTGAAATGG + Intergenic
1177841395 21:26237733-26237755 ATTCATCCTCACTAGTGAGATGG - Intergenic
1178183723 21:30194824-30194846 TTTCATCTTCTCTATTTACAAGG + Intergenic
1178605899 21:34036362-34036384 TTTGATCCTCACCACTGCCCGGG - Intergenic
1179794353 21:43774184-43774206 TCTGATCCTGACTTTGGACAAGG - Exonic
1184910958 22:47533829-47533851 TTTGTTCCTCATTTGTGACAAGG + Intergenic
950674055 3:14544164-14544186 TCTGATCCTCACTCCTCACAAGG - Intergenic
957934394 3:86923623-86923645 TTTGATACTCATTCTGGACATGG + Intergenic
959461199 3:106628163-106628185 TTTCGTGCTTACTATTGACAAGG - Intergenic
959579825 3:107971880-107971902 TTTGATCATCAGTCTTCACATGG - Intergenic
966335782 3:178866293-178866315 TATGATTCTCAATGTTGACAAGG + Intergenic
966632988 3:182099014-182099036 TTTGATCCACACAACTGACAGGG + Intergenic
966639410 3:182173013-182173035 TTTGATCTTCATTATGGAGAGGG - Intergenic
969143990 4:5104072-5104094 TTTGATATTAACTATTGATATGG + Intronic
969893712 4:10283039-10283061 TTTGATCTTCACTATCCAAAGGG - Intergenic
972968538 4:44543536-44543558 TTTGCTTCTAACTATTGATAGGG + Intergenic
974390604 4:61261842-61261864 TTTTATCCTCACTCTTTTCATGG - Intronic
974706585 4:65525455-65525477 ATTGATCCCCACTGTAGACAGGG - Intronic
975668410 4:76755766-76755788 TTTATTCCTCCCTATGGACATGG - Intronic
976562974 4:86522823-86522845 TTTGTTCCTCCCTCTTCACATGG + Intronic
977122616 4:93122064-93122086 TCTGTTCATCACTATTTACAGGG - Intronic
977452473 4:97216511-97216533 TTTGATCCTCACAATATATAAGG + Intronic
977452479 4:97216604-97216626 TTTGATCCTCACAATATATAAGG + Intronic
979227463 4:118304880-118304902 TTTGATTCTCAGTATTTCCAAGG + Intronic
979708495 4:123749586-123749608 CTTGCTCCTCACTAATGACCAGG - Intergenic
986755066 5:10827720-10827742 TTTAATTCTCAGTATTGAAATGG + Intergenic
987234962 5:15933698-15933720 TTTGAACCTCATTATTCCCAGGG + Intronic
990004984 5:50935359-50935381 TTTGATCCTCAGTGTTGGAATGG - Intergenic
992064932 5:73098261-73098283 TTTCATCCTCAGCTTTGACATGG + Intergenic
994506241 5:100646258-100646280 TTTGTACCTCACTAGTGACCTGG + Intergenic
995394129 5:111669590-111669612 TTCGCTCCTCACATTTGACAAGG - Intronic
995571860 5:113489173-113489195 TTTGATCCACACTACAGACCTGG + Intergenic
1001846434 5:174925892-174925914 TTTGATCCTCACAACTGCCCTGG - Intergenic
1003972904 6:11316108-11316130 TTGGATGCTGACTATTTACAAGG + Intronic
1004847348 6:19659689-19659711 TTTGATCCTCACGGTCAACATGG - Intergenic
1004907972 6:20254768-20254790 TTTGATCTTCTCTATGGACATGG + Intergenic
1005214845 6:23513282-23513304 TTTGCTTCTCAGTTTTGACAAGG - Intergenic
1005316717 6:24609791-24609813 TATGAGCCTGACTTTTGACAAGG + Intronic
1005362837 6:25047902-25047924 TTTGATCATCTCAATAGACATGG + Intergenic
1005626716 6:27669309-27669331 TTTCATTCTCAATATTGAAAGGG + Intergenic
1009287624 6:61841549-61841571 TTAGATCTTTACTAATGACATGG + Intronic
1011241225 6:85273235-85273257 TTGGATCCCCAGTGTTGACATGG - Intergenic
1011940419 6:92835878-92835900 ATTGATGCTGACTATTGACAGGG + Intergenic
1012384897 6:98669000-98669022 TTATATCCTCTATATTGACAGGG - Intergenic
1015286004 6:131487242-131487264 TTTGATCTTCAATATTGAAGGGG - Intergenic
1016360114 6:143258748-143258770 TTTCAACCTCAGTTTTGACAGGG - Intronic
1017139607 6:151178779-151178801 TTTAATCCTAACTATTAAAAAGG + Intergenic
1022639441 7:32167614-32167636 CTTGTCCCTCACTATTCACAGGG - Intronic
1023590215 7:41773675-41773697 TTTCTTCCTTACTTTTGACAAGG + Intergenic
1026201778 7:68220698-68220720 TCTGAAACTCACCATTGACATGG - Intergenic
1028322506 7:89477637-89477659 TTTGATCCTCCCTATTGATAGGG - Intergenic
1034945170 7:155257519-155257541 CTTGATCCTGACCATTGACAAGG + Intergenic
1036543396 8:9741519-9741541 TTTGATCCTCATTCTTCTCATGG + Intronic
1038322375 8:26539298-26539320 TTTGATGCTGACTATTCACTGGG - Intronic
1039707503 8:40022536-40022558 TTGGAACCTCCCTATTGACTTGG + Intergenic
1040270588 8:45937221-45937243 TTTGAACCTTTCTACTGACAGGG + Intergenic
1040410057 8:47144966-47144988 TCTGGTACCCACTATTGACATGG - Intergenic
1040497821 8:47982267-47982289 TCAGATCCTCACTTCTGACAGGG - Intergenic
1042786772 8:72556454-72556476 AATGATCCTCACTAATGATAAGG + Intronic
1049921311 9:367057-367079 TTTGTTCCTCACTTGTGACATGG + Intronic
1053572963 9:39329008-39329030 TTTGGTCCTCTCTTTGGACAGGG - Intergenic
1053624312 9:39853197-39853219 TTTGGTCCTCTCTTTGGACAGGG - Intergenic
1053711696 9:40817840-40817862 GTTGATCCTTTCTTTTGACAGGG + Intergenic
1053880557 9:42590030-42590052 TTTGGTCCTCTCTTTGGACAGGG + Intergenic
1053892113 9:42704300-42704322 TTTGGTCCTCTCTTTGGACAGGG - Intergenic
1054124181 9:61290003-61290025 TTTGGTCCTCTCTTTGGACAGGG + Intergenic
1054219584 9:62397500-62397522 TTTGGTCCTCTCTTTGGACAGGG + Intergenic
1054231130 9:62511673-62511695 TTTGGTCCTCTCTTTGGACAGGG - Intergenic
1054422160 9:64949718-64949740 GTTGATCCTTTCTTTTGACAGGG + Intergenic
1054764036 9:69027758-69027780 TTTGATTGTCACTATTGAATGGG + Intergenic
1056178189 9:84056262-84056284 TTTGGTCCTCACTTTTTACTCGG + Intergenic
1056472746 9:86921583-86921605 TTTAAGCCTCCCTATTGATAAGG - Intergenic
1056529500 9:87474384-87474406 TTTGGTCTTCTCTATTGAGAAGG - Intergenic
1056994134 9:91439751-91439773 TCTGATCCTCTGAATTGACAAGG - Intergenic
1058559188 9:106206191-106206213 TTTGATCCTCTGTAGTGAAAGGG + Intergenic
1059283794 9:113155953-113155975 TTTGGTCCTAACTGTTGAGAGGG + Intronic
1059686448 9:116641850-116641872 TTTGATCTTCCCTGTTGCCAAGG + Intronic
1061522549 9:131128039-131128061 TATGATCCAAACTATTGGCAAGG + Intronic
1185636050 X:1552908-1552930 TTGGTTCTTCACTATTCACATGG + Intergenic
1191086929 X:56578473-56578495 TATGATCATCTCTATAGACAGGG - Intergenic
1193095049 X:77538702-77538724 TTTGATCCTCACAATTGCTCAGG - Intronic
1193187128 X:78526773-78526795 TGGGATCCTCAAAATTGACATGG + Intergenic
1193200180 X:78680337-78680359 TTTTCTTCTCACTGTTGACATGG + Intergenic
1194709289 X:97215520-97215542 TTTCATCTTCAATAATGACATGG - Intronic
1194907764 X:99599195-99599217 TTTGACACTCACTTTTTACAGGG - Intergenic
1194919997 X:99753253-99753275 TTTTCTCCTCACTATTCACTTGG + Intergenic
1197731621 X:129814968-129814990 TTTGATCCTCACAATTTCCCTGG + Intronic
1198439859 X:136652585-136652607 TTTGAACATCTCTAGTGACAAGG + Intronic
1199373441 X:147078984-147079006 TTTGATCCAAACTACTGAAAAGG - Intergenic