ID: 910684062

View in Genome Browser
Species Human (GRCh38)
Location 1:89898235-89898257
Sequence ATCTAAAAGCAATTCATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910684058_910684062 -7 Left 910684058 1:89898219-89898241 CCACCACATTTATCAAATCTAAA No data
Right 910684062 1:89898235-89898257 ATCTAAAAGCAATTCATGGGAGG No data
910684056_910684062 23 Left 910684056 1:89898189-89898211 CCAGAGTTAACTGATGCTGTAGA 0: 1
1: 0
2: 0
3: 10
4: 102
Right 910684062 1:89898235-89898257 ATCTAAAAGCAATTCATGGGAGG No data
910684059_910684062 -10 Left 910684059 1:89898222-89898244 CCACATTTATCAAATCTAAAAGC 0: 1
1: 0
2: 1
3: 18
4: 367
Right 910684062 1:89898235-89898257 ATCTAAAAGCAATTCATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910684062 Original CRISPR ATCTAAAAGCAATTCATGGG AGG Intronic
No off target data available for this crispr