ID: 910684900

View in Genome Browser
Species Human (GRCh38)
Location 1:89906118-89906140
Sequence AGAAGTAAACAGCAGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910684900_910684905 12 Left 910684900 1:89906118-89906140 CCCCCCAACTGCTGTTTACTTCT 0: 1
1: 0
2: 0
3: 28
4: 241
Right 910684905 1:89906153-89906175 TTCTTTCAAGCATCACTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910684900 Original CRISPR AGAAGTAAACAGCAGTTGGG GGG (reversed) Intronic
900142080 1:1142932-1142954 AGACGAGAACAGCAGCTGGGGGG - Intergenic
900751502 1:4400781-4400803 AGAAGAATACAGCTGCTGGGCGG - Intergenic
901013711 1:6215640-6215662 ACAAGCAAAAAGCAATTGGGAGG - Intronic
902412820 1:16221354-16221376 AGAAGTAAACAGCAAATGAGTGG + Intergenic
909182408 1:72440579-72440601 AGGAGAACACAGCAGTTGGGAGG - Intergenic
910093649 1:83495065-83495087 AGAAGAAAACAGGAAATGGGGGG + Intergenic
910132793 1:83928880-83928902 AGCAGTATACAGGAGTAGGGGGG + Intronic
910684900 1:89906118-89906140 AGAAGTAAACAGCAGTTGGGGGG - Intronic
912604584 1:110976129-110976151 AGCAGAAAACAGCAGCTAGGAGG - Intergenic
912664006 1:111562708-111562730 AGAAGTAAACAGCAATATAGAGG - Intronic
913375668 1:118149074-118149096 AGAAGAAAAGAGAAGGTGGGTGG - Intronic
915086324 1:153391287-153391309 AGAAGGAAAAAGCAGGTAGGGGG + Intergenic
915293080 1:154899393-154899415 AGAAGTGAACAGAATTTGGATGG - Intergenic
919556274 1:199058095-199058117 AGAAGTATGCAGCTCTTGGGAGG - Intergenic
920674051 1:208026801-208026823 AGAATTAAACAAAAGTTGGACGG + Exonic
921671273 1:217926599-217926621 AGAAGTAAAGACAAATTGGGGGG - Intergenic
923937868 1:238784351-238784373 AGAGGGAAACAGAAGTTGGAAGG + Intergenic
924442830 1:244100899-244100921 AGCAGGAAACAGCTGTTGAGTGG - Intergenic
924668972 1:246103819-246103841 AGAAGTGATCAGCAGATGGGTGG - Intronic
1063675496 10:8137781-8137803 GGAAGTAACCAGGAGTGGGGAGG + Intergenic
1063764232 10:9119536-9119558 CGTAGGAAACAGAAGTTGGGAGG + Intergenic
1063937711 10:11096266-11096288 AGAAGTAATTAGCAGGAGGGAGG - Intronic
1064188577 10:13185509-13185531 AGACATAAACAGGAGTTGGTAGG - Intronic
1066544450 10:36484195-36484217 AGAAGAAAACATAAGATGGGAGG + Intergenic
1067085809 10:43237538-43237560 AGAAGAAAAGAGAGGTTGGGAGG - Intronic
1067758688 10:49026560-49026582 AGAAGTGACCAGATGTTGGGAGG + Intronic
1067800104 10:49352929-49352951 AGAAGCAAACACAACTTGGGAGG - Intergenic
1069842412 10:71348066-71348088 AGAAGCAGACAGCCGCTGGGAGG + Intronic
1070577957 10:77694158-77694180 AGAAGTCATCAGCAGTGGTGAGG + Intergenic
1072099163 10:92213109-92213131 AGAAGTAAACAAGATTTGGGTGG - Intronic
1073444771 10:103574142-103574164 TGAAGAAAACGGCAGGTGGGTGG + Intronic
1073708821 10:106016426-106016448 AGAAGTGCAGAGCAGTGGGGGGG + Intergenic
1074278439 10:112027053-112027075 AGAAGGAAATAGCAGATGGGGGG - Intergenic
1074762030 10:116674297-116674319 AGAAATTAACTGCAGATGGGTGG + Exonic
1074973082 10:118557902-118557924 AGCAGAAAGCAGCAGTTGGGAGG - Intergenic
1075418455 10:122282963-122282985 AGATGAAAGCAGCAGTTGGCAGG + Intronic
1077891880 11:6424560-6424582 AGAAGTAGACAGCAGAATGGTGG + Intergenic
1078902876 11:15657884-15657906 AGAAGAAAAAAGCAGATGGTTGG - Intergenic
1079384839 11:19969644-19969666 AGAAATTAACAACAGTTGGCTGG + Intronic
1079594205 11:22222071-22222093 AAAAGTAAACATCACTTGAGAGG - Intronic
1080127155 11:28749126-28749148 AGAAGAAAATAGCAGTTGAGAGG - Intergenic
1080242761 11:30145989-30146011 AGAAGTAAAGAGCAGTATGGTGG + Intergenic
1080951855 11:37043084-37043106 ATAAGTAAACTGAAGTTGGAGGG - Intergenic
1081774518 11:45668202-45668224 GAAAGGAAACAGCAGCTGGGTGG + Intergenic
1082942736 11:58725696-58725718 AGAAGTAAAGTGCATTTGGAAGG + Intronic
1084157315 11:67321108-67321130 TGAATTAAACAGGACTTGGGAGG - Intronic
1084768027 11:71325057-71325079 AAAAGCACACAGCAGTGGGGAGG + Intergenic
1085435537 11:76496860-76496882 AGAAATAAACAGCAATTGATTGG - Intronic
1087271325 11:96114867-96114889 AGAAATAAACAGGAGTAGGGAGG + Intronic
1087822452 11:102727707-102727729 AAAGGTAAAGAGCATTTGGGTGG + Intergenic
1088190072 11:107218738-107218760 TGAAGTAAACTGCAGTCAGGGGG - Intergenic
1088816596 11:113425383-113425405 AGAGGTAGACAGCAGGTGGAGGG + Intronic
1090213540 11:124940352-124940374 AGAAATAAACAGGAATTTGGGGG + Intergenic
1090466298 11:126937602-126937624 ATAAAAAAACAGCAGTTGGCCGG + Intronic
1090821700 11:130348402-130348424 AGAAGGAAACAACAGATGTGGGG + Intergenic
1090924990 11:131241630-131241652 AGAAGTAGACATGAGTAGGGAGG + Intergenic
1091975335 12:4820059-4820081 AGAACAAAACTGCAGTTGGCAGG - Intronic
1093549483 12:20390465-20390487 AAAAAAAAACTGCAGTTGGGAGG + Intronic
1095233385 12:39768608-39768630 AGAAGGAAACAGCTGGTTGGTGG + Intronic
1098832221 12:75376469-75376491 AGAAGCAAACAGCAGTGTTGAGG + Intronic
1101205570 12:102483812-102483834 AGAAGAAAAAAAAAGTTGGGGGG - Intergenic
1101250634 12:102931340-102931362 AGAGGGAAATAGCAGTGGGGTGG + Intronic
1101580653 12:106038558-106038580 AGCAGTACACAGCAGAAGGGGGG + Intergenic
1101727999 12:107403864-107403886 AGAAGTAAACAGCATATGGCCGG + Intronic
1104249959 12:127083254-127083276 AGTAGGAAGCAGCAGTTAGGAGG - Intergenic
1104324079 12:127779481-127779503 AGATGTAAACAGAAGTTGCTGGG - Intergenic
1104494236 12:129221655-129221677 AGAAGTCAACCACAGTTAGGAGG - Intronic
1104496790 12:129248475-129248497 AGCAGTAAATAGCAATTGAGGGG - Intronic
1104628629 12:130380337-130380359 AAAAGTAAAAAAAAGTTGGGGGG - Intergenic
1104879591 12:132061332-132061354 AGAAACATACAGCAGCTGGGTGG + Intronic
1108434441 13:50387892-50387914 AGAAGTAAACTGCAGCTGTTGGG - Intronic
1109462983 13:62687892-62687914 AGATTCAAACAGCAGATGGGAGG - Intergenic
1112606420 13:100910950-100910972 AGAAATAATCAGCAGTAGGTAGG + Intergenic
1114026479 14:18531761-18531783 AGAATCCAACAGCAGTTTGGTGG - Intergenic
1116817372 14:49596894-49596916 AGAAGAAAAAATTAGTTGGGCGG - Intronic
1117469615 14:56029205-56029227 AGAAGAATACTGCAGTTTGGAGG + Intergenic
1117616259 14:57536702-57536724 ACAAGAAAACAGTGGTTGGGTGG - Intergenic
1119729668 14:76943016-76943038 GGAAGTACAGAGCAGTTGGAAGG - Intergenic
1119971824 14:78979495-78979517 ATGAGTGAACAGTAGTTGGGTGG - Intronic
1120008739 14:79389247-79389269 AGAAGTCCAGATCAGTTGGGTGG + Intronic
1120989578 14:90363247-90363269 AGAAGCACACAGGAGGTGGGAGG + Intergenic
1121563939 14:94894685-94894707 AAAAGAAAACAGCAGTAGGCCGG - Intergenic
1122530067 14:102419139-102419161 AGGAGAGAACAGGAGTTGGGGGG + Intronic
1125280752 15:38040238-38040260 AGAAGTAAACATCAGGAGGCTGG + Intergenic
1125761003 15:42095419-42095441 ACAAGTAAACATTATTTGGGTGG + Intergenic
1126052145 15:44695723-44695745 AGGAGTAAACAGAACTTGGTGGG - Intronic
1129050254 15:72775230-72775252 GGAAGTAAACAGCACATGGCAGG + Intronic
1129219484 15:74123170-74123192 AGCAGTGCACAGCAGTTTGGGGG + Intronic
1129334402 15:74843578-74843600 AAAAGTGAAAAGCAGCTGGGAGG - Intergenic
1129780709 15:78268883-78268905 AGAAATATGCAGCAGTTGTGGGG + Intronic
1133153892 16:3858194-3858216 AGAATCAAACACCAGGTGGGTGG + Intronic
1134422897 16:14111239-14111261 AGAAGAAAATAACATTTGGGAGG + Intronic
1135547850 16:23377729-23377751 AGAAGGAAACAGAAGTGGGGAGG - Intronic
1137603912 16:49774648-49774670 AGAAGTAAGCAACAGGTGGGTGG + Intronic
1137726073 16:50657607-50657629 AGTAGTTGACATCAGTTGGGTGG - Intergenic
1138241085 16:55427725-55427747 AAAAGAAAACAGCAGATGAGAGG - Intronic
1138545536 16:57717220-57717242 AAAAAAAAACAGCAGGTGGGTGG - Intronic
1139046496 16:63066343-63066365 AAAAGTAAACATCAATAGGGAGG - Intergenic
1141671472 16:85494252-85494274 AGAAGCCACCAGAAGTTGGGAGG - Intergenic
1143323585 17:6083813-6083835 AGAAGTGACCAGCAGAGGGGAGG + Intronic
1146505831 17:33404489-33404511 AGAAGTAGACAGCCTTTGAGAGG - Intronic
1149669644 17:58394882-58394904 TGAAAGTAACAGCAGTTGGGAGG - Intronic
1150129591 17:62660422-62660444 AGCAAGAAACAGCAGCTGGGAGG + Intronic
1150472759 17:65451128-65451150 AGAAGGAAACAGCAGAGAGGAGG + Intergenic
1150731483 17:67698953-67698975 AGAAGTAAAAGGCAGGTTGGGGG - Intergenic
1152840773 17:82566719-82566741 AAAAGAAAGCAGCAGGTGGGAGG - Intronic
1152972633 18:178620-178642 ACAAGTAAAAAGCACTGGGGTGG - Intronic
1153275394 18:3362222-3362244 AGTTCTAAACATCAGTTGGGGGG + Intergenic
1153377854 18:4400917-4400939 AAAAGTAAACTTCAGTAGGGAGG - Intronic
1156926149 18:42582544-42582566 AGAAGTTAGCATCAGTTGGTAGG - Intergenic
1158101853 18:53838620-53838642 AGAATTTAAGAGCAGTTGGTGGG - Intergenic
1158710234 18:59830966-59830988 AGAAGTGAACAGCACTGGGAGGG - Intergenic
1158817483 18:61120012-61120034 AGAAGTAGACAGCAGAAAGGTGG - Intergenic
1159592829 18:70353382-70353404 AGAAGAAAACAACAGCAGGGAGG + Intergenic
1160161436 18:76474768-76474790 AGAAGAAAAAAGAGGTTGGGAGG + Intronic
1161586352 19:5107879-5107901 AGAAGCAAACAGCAGGAAGGAGG - Intronic
1164421288 19:28095468-28095490 GGAAGTAAACAGCATTTGGAAGG - Intergenic
1164988807 19:32669700-32669722 AGAAGAAAACAGCAGTGGTCGGG + Intronic
1165871491 19:38976030-38976052 AGAAGGAAACGGAATTTGGGTGG - Intergenic
1168396134 19:56050321-56050343 AGAAGCAGACTGCAGCTGGGAGG + Intronic
926881362 2:17548149-17548171 AGTAGGAAAGAGCAGTTGGAAGG - Intronic
926991795 2:18688177-18688199 AGAAGAACACAGCAATTGTGAGG - Intergenic
927115197 2:19892721-19892743 AGAATTAAACAGTCGTTGAGTGG + Intergenic
927466131 2:23338066-23338088 AGAAGTAGAGAGCAGAAGGGTGG + Intergenic
927512764 2:23654680-23654702 AGAAGGGAACAGAGGTTGGGGGG + Intronic
930216298 2:48700812-48700834 ATAAGTAAACAGAAGTTATGGGG + Intronic
932509663 2:72272847-72272869 AAAAGTACAAAGCAGGTGGGAGG + Intronic
932518281 2:72377666-72377688 AGAAGTAGACAGCAGAATGGTGG + Intronic
933208068 2:79532649-79532671 AGAATTAAGCAGCAGCTTGGCGG - Intronic
934858755 2:97746145-97746167 AGAAGTTACCAGGAGCTGGGGGG + Intergenic
936825555 2:116577193-116577215 AGGAGAAAACAGCAATTGTGAGG - Intergenic
937219342 2:120332844-120332866 AGAAGGAACATGCAGTTGGGAGG - Intergenic
938157946 2:128957462-128957484 AGAAGTAAAAAGCAGTGGGAGGG + Intergenic
938291043 2:130150675-130150697 AGAAGCAAAATGCAGTTGGGGGG - Intergenic
938690039 2:133779173-133779195 TGAAGGAAAGAGCAGATGGGAGG - Intergenic
939337830 2:140853506-140853528 AGAAGTAAATAGCAGTCCTGTGG + Intronic
939545437 2:143546570-143546592 AGATCTACACAGCAGTGGGGTGG - Intronic
942126823 2:172834593-172834615 AGAAGAAAAAAGCAGTTGCTTGG - Intronic
942138884 2:172956982-172957004 AGAAGAAAACTGCAGGTGGATGG + Intronic
943532123 2:189095793-189095815 AGAAAATAACATCAGTTGGGTGG - Intronic
944887606 2:204080337-204080359 AGAAAATAAGAGCAGTTGGGGGG + Intergenic
945611306 2:212007171-212007193 AGAAGTTAACAAAAGTGGGGTGG + Intronic
946141776 2:217697359-217697381 AGAAGAAAAGAGAAGATGGGAGG - Intronic
947477660 2:230465559-230465581 AGAAGGAAACAGCAGATGCTGGG + Intronic
947645854 2:231739266-231739288 AAAAGTAAACAAGAGTTGGTGGG - Intronic
948685419 2:239666765-239666787 AGAAGAAAGGAGCAGGTGGGAGG - Intergenic
1169913302 20:10664633-10664655 AGAAGTCAACCTCACTTGGGCGG + Intronic
1173403873 20:42748350-42748372 AGAAGTAAAGAGGAGCTGGAGGG - Intronic
1175107225 20:56624203-56624225 AGAGGTTACCAGCAGGTGGGTGG + Intergenic
1178555328 21:33585652-33585674 AGAAGTGAAAAGCAATTGGGTGG - Intronic
1180450613 22:15458957-15458979 AGAATCCAACAGCAGTTTGGTGG - Intergenic
1180672365 22:17563153-17563175 AGAAATCAACAGCAGTTGTGGGG - Intergenic
1181299371 22:21868340-21868362 AGAAGTACAAAGCAGAAGGGAGG + Intergenic
1181823819 22:25497060-25497082 AGATCTAAACAGAAGTTAGGAGG - Intergenic
1182464721 22:30507234-30507256 AAAAGAAAACAGAAGTTGGCTGG + Intergenic
1185112161 22:48906110-48906132 AGAAGTCAACTGGAGTTGGGAGG - Intergenic
949134726 3:550264-550286 AGAAATAGACAGCAGATGAGAGG + Intergenic
950469196 3:13174176-13174198 AGAAGTAAGAAGCAGGTGAGGGG + Intergenic
951492599 3:23289026-23289048 AGAATTAAACATCAGGTGAGTGG - Intronic
952073494 3:29668577-29668599 AGAAGTAACCAGAAGTTAGCTGG + Intronic
952173680 3:30838085-30838107 AAAAGGAAACAGCATTTGGGGGG - Intronic
952312791 3:32205473-32205495 AGAAATAAATAGCCCTTGGGTGG + Intergenic
953310394 3:41872286-41872308 AGCAGAAAGCAGCAGCTGGGAGG - Intronic
953482032 3:43260052-43260074 CAAAGTAGTCAGCAGTTGGGAGG - Intergenic
953835337 3:46338430-46338452 AGAAGGACACAGGATTTGGGAGG - Intergenic
954421814 3:50422885-50422907 AGAAGTAAACAGGATTTAGTTGG + Intronic
955058866 3:55479861-55479883 AGGAGGAAACAGCAGTTTGAGGG + Intronic
956497265 3:69841054-69841076 AGGAGTAAAAAGCAGTTTAGAGG - Intronic
958079753 3:88731676-88731698 ACAAGGAAACAGCAGTTTGGGGG - Intergenic
959500296 3:107099208-107099230 AGAGGAAAACAGCAGTGGAGAGG + Intergenic
961210604 3:125122463-125122485 ATAAGCAAAGAGAAGTTGGGAGG + Intronic
961863159 3:129934134-129934156 ATAAGTAAACTGGAGTTGAGAGG - Intergenic
963602034 3:147387164-147387186 TGAAGTATGCAGAAGTTGGGGGG - Exonic
964406136 3:156351503-156351525 AAAAGTAAAAAGAAATTGGGGGG - Intronic
966319248 3:178682344-178682366 AGGAGAAGACAGCAGTTGGAGGG - Intronic
966636177 3:182136269-182136291 ACATGTAAACAGCATCTGGGAGG - Intergenic
970512236 4:16792881-16792903 AGAAATAAACATCAATTTGGGGG + Intronic
971232159 4:24808634-24808656 AGAAGTAAACAGCCTTGGGAGGG - Exonic
971541508 4:27822852-27822874 AGAGATAAACAGGAATTGGGTGG - Intergenic
971965142 4:33544581-33544603 AGAAGTAGACATCACATGGGAGG + Intergenic
973729836 4:53812432-53812454 ACAAGTACACAGAAGATGGGGGG + Intronic
977044306 4:92050439-92050461 AGGAGAAAACAGCAATTGTGAGG + Intergenic
978141729 4:105325554-105325576 AGCAGGAAGTAGCAGTTGGGTGG - Intergenic
979617432 4:122759626-122759648 AGAAGTAAAAAGGTGTGGGGTGG - Intergenic
979701127 4:123668998-123669020 AGAAGCAAACAGCCATTGGGAGG + Intergenic
981420837 4:144548449-144548471 AGAAGGAAAAAGCAGGTGAGAGG + Intergenic
983058264 4:163125110-163125132 AAAAGGAAACAGCAGATGTGTGG - Intronic
986033720 5:3918140-3918162 AGATGGAGAGAGCAGTTGGGAGG - Intergenic
986579288 5:9248013-9248035 AGCATTAAACAGCAATTGTGTGG + Intronic
988233587 5:28509523-28509545 AGAAGTAAACAGCAGTGTTGGGG + Intergenic
988564194 5:32308025-32308047 AGAAATAAGCAACAGTTGGCTGG + Intronic
991618631 5:68522155-68522177 AGATGTTAACAGCAATTAGGAGG - Intergenic
994958148 5:106561894-106561916 AGAAGTAAACAGGGGTGGTGGGG - Intergenic
995716902 5:115089300-115089322 AAAAGTATAAAGCATTTGGGGGG + Intergenic
996458218 5:123709376-123709398 AGAAGAGAACAGCAGCTGGGAGG - Intergenic
996744088 5:126830424-126830446 AGAACCAAAAAGCTGTTGGGAGG - Intronic
997750496 5:136340273-136340295 AGAAGTAGAGAGCAGATTGGTGG + Intronic
997983085 5:138482190-138482212 AGAAGCCAACAGCAGTTGTCTGG - Intergenic
998050056 5:139024706-139024728 AGAATTAGACTGCAGGTGGGGGG - Intronic
998493230 5:142565042-142565064 AGAAGTAAACTACATTTTGGCGG - Intergenic
1001031337 5:168265561-168265583 AGAAGGACACAGAAGGTGGGTGG + Intergenic
1002369547 5:178740685-178740707 AGTAGCAAACAACAGTTGAGAGG + Intergenic
1005544377 6:26849924-26849946 AGAAGTAGACAGCAGAATGGTGG + Intergenic
1005719153 6:28583752-28583774 AGAAGTGAAAAGCTCTTGGGAGG + Intronic
1005776257 6:29134331-29134353 AGAAATAGACATCAGTTGGCCGG - Intergenic
1007478925 6:42137389-42137411 AGGAGTAAACAAAAGTTGGTAGG + Intronic
1007782858 6:44264245-44264267 TGAAGTAAAAGGCAGTTGTGTGG - Intronic
1009551242 6:65095220-65095242 AGAAGTAAACAGTAAAAGGGTGG + Intronic
1010866014 6:80977630-80977652 AACAGTAAAGAGCTGTTGGGAGG + Intergenic
1011117702 6:83912173-83912195 AGAGGAAAACAGTAGATGGGAGG - Intronic
1011633721 6:89352147-89352169 AGAAGTAAATAGAAGTCCGGTGG + Intronic
1012180250 6:96143897-96143919 AAAAATTAAAAGCAGTTGGGTGG - Intronic
1013001861 6:106030945-106030967 AGAAGTTAACAATAGTTGGTAGG + Intergenic
1014668443 6:124270040-124270062 GGAAGGAAAGAGCAGATGGGAGG + Intronic
1014762632 6:125374513-125374535 AGAAGTAAACAGCAAATTAGTGG - Intergenic
1017777193 6:157689495-157689517 AGAAGGAAGGAGCAGTGGGGAGG - Intergenic
1018691284 6:166346097-166346119 AGAGGTAAAGAGAATTTGGGGGG + Intergenic
1023296438 7:38719836-38719858 AGAAGTGAACAGCAGGAGGCAGG - Intergenic
1024747644 7:52426989-52427011 AGTAGGAACCAGCAGATGGGAGG + Intergenic
1024891560 7:54210219-54210241 GGAAGAACACAGCAGTTGTGAGG + Intergenic
1027220424 7:76210415-76210437 AGAAGAAGACAGCATTTGAGAGG - Intronic
1028066924 7:86396951-86396973 AGAAGTCAACAGAAATTTGGGGG + Intergenic
1028161800 7:87494126-87494148 TAAAGTAAACAGCAGTGTGGAGG + Intergenic
1029944204 7:104514566-104514588 AGATATAAAAAGCAGTTGGCTGG + Intronic
1031680369 7:124665652-124665674 AGAAACAAACAGCATTTGGTCGG - Intergenic
1032149360 7:129414713-129414735 AGAAATAAACAACACTTGGCTGG - Intronic
1034112858 7:148555277-148555299 AAAAGAAAACAGCAGATGGATGG + Intergenic
1035409693 7:158629560-158629582 AAAAATAAATAGCTGTTGGGTGG - Intergenic
1036402832 8:8425743-8425765 AGATGTAAACAGTATTTTGGGGG + Intergenic
1036921836 8:12863724-12863746 AGAAGTTACCAGTGGTTGGGGGG - Intergenic
1037743233 8:21623651-21623673 AGAAGGAAAAAGCAAATGGGAGG + Intergenic
1037870282 8:22487896-22487918 AGAAGTAAAAAGTAATTGAGTGG + Intronic
1039376772 8:37042416-37042438 AGAAGTCATCGGCATTTGGGAGG + Intergenic
1040468256 8:47715112-47715134 AGAAGCAAACAGTAGATTGGTGG - Intronic
1041447284 8:57966379-57966401 AGAAGTAAACAGCACATGGCAGG - Intergenic
1041495555 8:58481919-58481941 AGAGGAAAACAGGAGTGGGGTGG + Intergenic
1041777092 8:61535259-61535281 AAAAGCAAACAGCAGATGGAAGG + Intronic
1045055879 8:98368070-98368092 AGAGAAAAACAGCAGTGGGGAGG + Intergenic
1045523665 8:102925180-102925202 ACAGTTAGACAGCAGTTGGGTGG + Intronic
1045911071 8:107410388-107410410 AGAAGAAAGCAGCACTTGGGAGG - Intronic
1046995444 8:120515753-120515775 AGAAGAAAACTGAACTTGGGAGG + Intronic
1047023993 8:120807700-120807722 AGCAGGAAACAGCAATTGTGTGG - Intronic
1047362269 8:124179864-124179886 AGAAAGAAACAGCTGTTGGTGGG - Intergenic
1049699180 8:144000235-144000257 TGAAGTCAACTGCAGTGGGGTGG + Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1055505521 9:76944395-76944417 AGAAGCAACCAGGAGGTGGGAGG - Intergenic
1056211568 9:84369531-84369553 GGGAGTAAACAGCAGTTGTAAGG - Intergenic
1056847307 9:90051694-90051716 AGAACTCAACAGCAGATGGAGGG - Intergenic
1059670664 9:116489015-116489037 AGAAGAAAACAACAGTTGAGAGG - Intronic
1060089519 9:120730814-120730836 CTAAGCAAACAGCAGGTGGGCGG + Intergenic
1060994086 9:127866435-127866457 AGAAATAAACAGGAGTTCAGCGG - Intergenic
1203346640 Un_KI270442v1:39500-39522 TGAAGTAAAGAGCAGTGGAGTGG + Intergenic
1185550562 X:980384-980406 AAGATTAAACAGCTGTTGGGGGG + Intergenic
1185769187 X:2752185-2752207 AGAAGTCAACAACAGGAGGGTGG + Exonic
1185999253 X:4989533-4989555 AGAAGAAAAAAGAAGTAGGGAGG - Intergenic
1187080048 X:15976503-15976525 AGAAGTTAAAAGCAGTTTTGGGG + Intergenic
1188068993 X:25695944-25695966 AGGAGAACACAGCAATTGGGAGG - Intergenic
1191660299 X:63642539-63642561 AGAAGTAATAAGCAGTTGAAGGG + Intronic
1192103267 X:68288391-68288413 AGAAGAAAACACCATTTGTGGGG - Intronic
1193787579 X:85778367-85778389 AGAAGTAAACAGCATTTTACTGG - Intergenic
1194079436 X:89440500-89440522 AGAAGGAGAAAGCAGTTGGGAGG + Intergenic
1194247565 X:91534876-91534898 AGAAGAACACAGCAATTGTGAGG - Intergenic
1195565587 X:106335603-106335625 AGAAGTAAAATGTAGTTGAGAGG + Intergenic
1197465362 X:126798674-126798696 AGAAGAACACAGCAATTGTGAGG + Intergenic
1199557806 X:149128015-149128037 AGACTTAAAAAGCAGTTTGGGGG - Intergenic
1199635959 X:149811592-149811614 AGAATCAAACAGAATTTGGGTGG + Intergenic
1200432054 Y:3095805-3095827 AGAAGGAGAAAGCAGTTGGGAGG + Intergenic
1200566587 Y:4776409-4776431 AGAAGAACACAGCAATTGTGAGG - Intergenic
1200894840 Y:8364242-8364264 AGATGTAAACTGCAGTTGAATGG + Intergenic
1201301319 Y:12507437-12507459 AGAAGTCAACAACAGGAGGGTGG - Intergenic