ID: 910689949

View in Genome Browser
Species Human (GRCh38)
Location 1:89955455-89955477
Sequence ATGAAGGTCTTCAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910689949_910689955 16 Left 910689949 1:89955455-89955477 CCCTCTTCCCTGAAGACCTTCAT No data
Right 910689955 1:89955494-89955516 GCTATACCCAGAGCTACATAGGG No data
910689949_910689956 17 Left 910689949 1:89955455-89955477 CCCTCTTCCCTGAAGACCTTCAT No data
Right 910689956 1:89955495-89955517 CTATACCCAGAGCTACATAGGGG No data
910689949_910689957 18 Left 910689949 1:89955455-89955477 CCCTCTTCCCTGAAGACCTTCAT No data
Right 910689957 1:89955496-89955518 TATACCCAGAGCTACATAGGGGG No data
910689949_910689954 15 Left 910689949 1:89955455-89955477 CCCTCTTCCCTGAAGACCTTCAT No data
Right 910689954 1:89955493-89955515 TGCTATACCCAGAGCTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910689949 Original CRISPR ATGAAGGTCTTCAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr