ID: 910695949

View in Genome Browser
Species Human (GRCh38)
Location 1:90015868-90015890
Sequence TAGATTGAAGTGACTCTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910695947_910695949 30 Left 910695947 1:90015815-90015837 CCATCAAAGCAAACAGGAATGTG 0: 1
1: 0
2: 1
3: 21
4: 220
Right 910695949 1:90015868-90015890 TAGATTGAAGTGACTCTAATGGG 0: 1
1: 0
2: 1
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910695949 Original CRISPR TAGATTGAAGTGACTCTAAT GGG Intronic
901151080 1:7102255-7102277 TAGTTTGAGGTGACTCTGGTGGG + Intronic
907071262 1:51537256-51537278 TAGTTTGAAGAGGCTCTCATTGG - Intergenic
907360718 1:53912307-53912329 TAAGTTGAAGAGAATCTAATTGG - Intergenic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
909557927 1:76975518-76975540 TAAATTGGAGTTACTTTAATAGG + Intronic
910009753 1:82446978-82447000 AATATTGTAGTTACTCTAATAGG + Intergenic
910131461 1:83912270-83912292 TAGAAACAAGTGATTCTAATAGG - Intronic
910695949 1:90015868-90015890 TAGATTGAAGTGACTCTAATGGG + Intronic
911175735 1:94816117-94816139 TATAATGAATTGACTCTCATGGG + Intergenic
916337025 1:163684338-163684360 AAAATGAAAGTGACTCTAATTGG + Intergenic
916544396 1:165788606-165788628 TAGAGGGAAATGACTCTAAAAGG + Intronic
917250892 1:173059739-173059761 GAGATTGGAGTGACTTTACTGGG + Intergenic
917414295 1:174792496-174792518 TTAATTGAGGTGACTCTTATAGG + Intronic
918561580 1:185874489-185874511 AAGAGTGAATTGACTGTAATAGG + Intronic
919591257 1:199505630-199505652 CAGATTGAAGTGGCTCTCACTGG + Intergenic
921780598 1:219158435-219158457 CAGATTGCAGTGACTCGAGTTGG - Intergenic
924491551 1:244542926-244542948 TTGATAAAAGTCACTCTAATAGG - Intronic
1071170264 10:82855994-82856016 TAGATTCAAGTGAGTAGAATTGG + Intronic
1080211106 11:29786395-29786417 TGGATTTAAGTCATTCTAATAGG + Intergenic
1081129557 11:39361779-39361801 TAGATTGAAGCCATTCTAAGAGG + Intergenic
1082094277 11:48115215-48115237 TTGTTTGAATTGACTCTGATTGG - Intronic
1085583133 11:77673450-77673472 TAGGTTGAAGTGGTTCTCATTGG + Intronic
1086579197 11:88377473-88377495 TAGATTTAAATGAGTTTAATGGG - Intergenic
1086959557 11:92968772-92968794 TTGATTTTAGTGATTCTAATGGG + Intergenic
1088544618 11:110947022-110947044 CACATGGAAGTGACTCTAAATGG + Intergenic
1089110950 11:116055584-116055606 TAGATTAAAGTGCCCCAAATTGG - Intergenic
1093044940 12:14432172-14432194 TGGCTTGGAGTCACTCTAATTGG + Intronic
1095200948 12:39383486-39383508 TAAATTGAATTGACTCTAGGAGG - Intronic
1099986650 12:89673312-89673334 TAGTTTGAAGTGATATTAATAGG - Intronic
1101566882 12:105914667-105914689 TGGATTTAAGTCATTCTAATGGG - Intergenic
1102000697 12:109556392-109556414 TAGATTGAAGTGTGTGTGATGGG - Exonic
1103827110 12:123748214-123748236 TAGCTTGAAGTCACTATAACAGG + Intronic
1109278851 13:60332231-60332253 TAGATTGCATTGGCTATAATTGG + Intergenic
1109726405 13:66346960-66346982 TACAATGAAGTGACTTTATTGGG - Intronic
1111403489 13:87770972-87770994 TAGAGTGAAGTGACTCGAACAGG + Intergenic
1111439055 13:88254341-88254363 TTAAATGAAGTGATTCTAATTGG + Intergenic
1113347812 13:109497765-109497787 TAGATTCAAATGGCTTTAATGGG - Intergenic
1114390464 14:22302596-22302618 TTGATTGCAGTGAGTATAATGGG + Intergenic
1118806489 14:69241647-69241669 TAGACTGAAGTGACCCAGATGGG - Exonic
1120351205 14:83361125-83361147 TAGTTTGAAGTGAATTTTATGGG - Intergenic
1122177041 14:99928314-99928336 TAGGTGGAAGTTACTCTAGTTGG + Intronic
1123052322 14:105550876-105550898 TATATTGAAATGACCCCAATAGG - Intergenic
1124568614 15:30838954-30838976 TAGAATGAAGAGACTCAAGTAGG - Intergenic
1135662570 16:24309386-24309408 AAGAGTGAAGTGACTCTGACAGG - Intronic
1140298939 16:73737646-73737668 TAAATTGAAATGACTAAAATGGG - Intergenic
1149125845 17:53231229-53231251 TAGATTGTTGTGATTTTAATTGG - Intergenic
1152973695 18:191804-191826 TTGATTTTAGTCACTCTAATGGG + Intronic
1156850667 18:41722078-41722100 TACACTGAAGTGTCTCTAAAAGG + Intergenic
1157691971 18:49691261-49691283 TAGATTCAAATGACTCAGATGGG - Intergenic
1164893826 19:31851185-31851207 TAGATTTTAGTCATTCTAATAGG - Intergenic
1168460184 19:56548242-56548264 TAAATTAAAGTGACTCACATGGG + Intronic
929912970 2:46107736-46107758 TGGATTGTAGTCATTCTAATAGG + Intronic
929974654 2:46620639-46620661 TAGATTGAAGTCACTCTAAAAGG - Intronic
930447629 2:51495378-51495400 TACATTGAAGTGACACTGCTGGG - Intergenic
937699010 2:124842194-124842216 TAAATGTAAGTGACTCTAATTGG + Intronic
937774440 2:125759302-125759324 CAGATTGAAGGAACTCTCATTGG - Intergenic
940774384 2:157871573-157871595 AACAATGAAGTAACTCTAATGGG + Intronic
946474928 2:219997865-219997887 TAGATTGAAGGGACTCTACCTGG + Intergenic
1174063165 20:47846413-47846435 GAGATTGAAGTGTGTCTGATGGG - Intergenic
1174151517 20:48489443-48489465 GAGATTGAAGTGTGTCTGATGGG - Intergenic
1175460245 20:59146879-59146901 AAAATAGAAGGGACTCTAATAGG + Intergenic
1177110193 21:17018050-17018072 TGGATTTTAGTCACTCTAATAGG - Intergenic
1182852803 22:33490603-33490625 CAGATTGATCTGACTCTAGTTGG - Intronic
949673893 3:6430695-6430717 TAAAATGAATTGACTCTAATTGG - Intergenic
949764268 3:7508773-7508795 TATCTTGAGCTGACTCTAATAGG - Intronic
953760016 3:45679209-45679231 TAGATTGAGGTGATTCAGATAGG + Exonic
955727956 3:61952792-61952814 TGGATTCAAGTGACACTGATAGG - Intronic
958428658 3:94010666-94010688 TAGATTAAGGTGATACTAATTGG + Intronic
964455731 3:156863797-156863819 TAGAGTGAAGAGACTGTCATTGG + Intronic
974480821 4:62440552-62440574 TAGATTTTAGTCACCCTAATAGG + Intergenic
975536663 4:75458636-75458658 AAGATTAGAGTGACTCTAACTGG - Intergenic
976448372 4:85158598-85158620 GAGCTTGAAGTCACTGTAATGGG + Intergenic
977227444 4:94410041-94410063 TAAATTGAAATGACACCAATTGG + Intergenic
977814289 4:101396510-101396532 TATATTGAAGGGACTGTAATAGG - Intergenic
980097571 4:128507984-128508006 TAAATAGAAGTGATTATAATGGG + Intergenic
980412703 4:132444450-132444472 TATGTTGAAGTGACACTAAGAGG + Intronic
981666281 4:147230618-147230640 TAGAGTAAAGTGACTCTGAGTGG - Intergenic
981800509 4:148649808-148649830 TAGATTGAGTTGACTCTTAGAGG + Intergenic
982940987 4:161554560-161554582 TAGAATGAAGTCACTGTATTGGG - Intronic
983970293 4:173863462-173863484 TAGATGGAAATTAGTCTAATTGG - Intergenic
984606431 4:181790632-181790654 TAGATTGAAATGTCTGTGATGGG - Intergenic
986464396 5:8007031-8007053 TTGTTTGAAGTGATTCTTATTGG + Intergenic
986610695 5:9564290-9564312 TAGTTTGATGTGACTATACTTGG - Intergenic
988066074 5:26229679-26229701 TAAATATAAATGACTCTAATAGG - Intergenic
988868535 5:35361971-35361993 TAGGTTGAACAGACTCTGATGGG + Intergenic
1000282418 5:159793643-159793665 TAAATTGTAGAGCCTCTAATGGG - Intergenic
1000447591 5:161343046-161343068 AAGATCCCAGTGACTCTAATTGG - Intronic
1000810200 5:165852036-165852058 TTGATTAAAGTGACCCTAAAGGG - Intergenic
1000884720 5:166737981-166738003 CAGATTGAAGAGGCTCAAATTGG + Intergenic
1001778297 5:174345537-174345559 TACATTGAAGTGACCTTATTTGG - Intergenic
1001929205 5:175660757-175660779 TAGACTGAATTGCCTCTAAAAGG + Intronic
1004651213 6:17611214-17611236 TAGATTCAAGTGACAGTAAAAGG + Exonic
1004662586 6:17723313-17723335 TATATGGAAGGGACTCTAACTGG - Intergenic
1007933813 6:45715588-45715610 TAGATGCACTTGACTCTAATAGG - Intergenic
1011173827 6:84537897-84537919 TAAGTTGAAGTGACACTATTGGG - Intergenic
1012855608 6:104497820-104497842 TAAATGGAAGATACTCTAATGGG + Intergenic
1017373538 6:153740426-153740448 TAGTTTGAAGGGAATCTCATGGG - Intergenic
1018844488 6:167546375-167546397 TTGAATGATGTGATTCTAATAGG + Intergenic
1022829387 7:34049954-34049976 TAGACAGAAGTGATTATAATGGG + Intronic
1026471529 7:70696792-70696814 CCTATTAAAGTGACTCTAATTGG - Intronic
1029790141 7:102834326-102834348 TAGATTTTAGTAACCCTAATGGG + Intronic
1030869593 7:114738653-114738675 TAAATTTAAGTGAATCTAAATGG + Intergenic
1031252775 7:119409416-119409438 TAGATTGTACTCACTTTAATAGG + Intergenic
1031601172 7:123712118-123712140 TAGGTTGAAATGACTTTTATTGG + Intronic
1036500193 8:9307173-9307195 AAGATTGAAGTGATTCTCACTGG + Intergenic
1037327397 8:17706629-17706651 TTGAGTGAAGTGACTGTAAATGG + Intronic
1043353157 8:79385883-79385905 TGGATTCAAGTAACTTTAATTGG - Intergenic
1044063842 8:87673904-87673926 CAGATTGATGTGAGTCTTATTGG - Intergenic
1045764521 8:105651019-105651041 TCCATTGAAGTGACTCTTACAGG + Intronic
1046019391 8:108646151-108646173 TAAATTGAAATGACTGTATTAGG + Intronic
1046323289 8:112606307-112606329 AAGATAGAAGTGAGTCTATTAGG - Intronic
1046400586 8:113698796-113698818 TTTATTGCAGTGACTCAAATAGG - Intergenic
1047803916 8:128338936-128338958 TTGAATGAAGTCATTCTAATGGG + Intergenic
1052021141 9:23526693-23526715 GAGATGGTAGTGACTGTAATTGG - Intergenic
1052053420 9:23875773-23875795 TAAATTGTAGTCACCCTAATGGG + Intergenic
1060590721 9:124814722-124814744 TAGAATGAAGCGAGTCTAGTAGG - Exonic
1062579393 9:137222677-137222699 TAGATCGCTGTGACTCTAAGGGG + Intergenic
1188911776 X:35857515-35857537 TAGAGTGTAGTTATTCTAATGGG + Intergenic
1191157661 X:57292896-57292918 TATTTGGCAGTGACTCTAATAGG + Intronic
1198219121 X:134583752-134583774 CAGATTGATGGGACTCTAGTTGG - Intronic