ID: 910697332

View in Genome Browser
Species Human (GRCh38)
Location 1:90033380-90033402
Sequence TCCCCCTGAATTGTTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910697332_910697334 9 Left 910697332 1:90033380-90033402 CCTGGGGAAACAATTCAGGGGGA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 910697334 1:90033412-90033434 CAAGTATAATTAGTATTATATGG 0: 1
1: 0
2: 2
3: 29
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910697332 Original CRISPR TCCCCCTGAATTGTTTCCCC AGG (reversed) Intronic
900416880 1:2539453-2539475 GCCCCCTGACTTGGTGCCCCTGG + Intergenic
900416998 1:2539935-2539957 GCCCCCTGACTTGGTGCCCCTGG - Intergenic
902845912 1:19110605-19110627 TACCCCAGAATGGTTTTCCCAGG - Intronic
904952921 1:34258791-34258813 TCCCCCTTGTTTTTTTCCCCTGG - Intergenic
905309957 1:37042449-37042471 TCCTCCTGAGTTGTTCCCTCAGG - Intergenic
906086194 1:43136707-43136729 TCCCCATGATTTGTTTCTCCTGG + Intergenic
907299488 1:53477691-53477713 TCTCCCTGACTGGTCTCCCCTGG - Intergenic
909911135 1:81259178-81259200 TCCCCTGGAATGCTTTCCCCAGG + Intergenic
910557631 1:88553508-88553530 TTCCCCAGAAATGTTTCCCCTGG - Intergenic
910697332 1:90033380-90033402 TCCCCCTGAATTGTTTCCCCAGG - Intronic
912565106 1:110581925-110581947 TCCCCCTGCATTGATTCCAATGG - Intergenic
914901403 1:151713125-151713147 TCCCTCTGGATTCTGTCCCCTGG + Intronic
915910080 1:159909459-159909481 TCTCCCTGATTTGTGTTCCCTGG + Intergenic
916995950 1:170301217-170301239 TCCCAAAGAATTGTTTCCTCTGG - Intergenic
920089098 1:203439826-203439848 TCCCCATGAATTGTTATTCCTGG - Intergenic
920823626 1:209403943-209403965 TACACCTGAAATGTTTCCCCAGG - Intergenic
1064113268 10:12556632-12556654 TCCCCCTGAACCCTTTGCCCTGG - Intronic
1065452739 10:25875620-25875642 TCACCCTGAGGTGTTTCTCCAGG - Intergenic
1065774904 10:29110501-29110523 TGACCCCGAATTGTCTCCCCAGG - Intergenic
1067341678 10:45410853-45410875 TCACCCTGAATTCTTTCCTGTGG - Intronic
1067772410 10:49136579-49136601 TCCCTCTGCATTTCTTCCCCTGG - Intergenic
1069658693 10:70109219-70109241 TTCCCCTGAGTTGATTCCTCCGG + Intronic
1069923868 10:71834556-71834578 TCGACCTGACTTATTTCCCCAGG + Intronic
1073043702 10:100623888-100623910 TTCCCCTGAATTATATCCCCAGG - Intergenic
1091626478 12:2124784-2124806 TCCTCCTGAAGTCTTTCTCCTGG - Intronic
1093429418 12:19067388-19067410 GTCCTCTGAATTGCTTCCCCCGG + Intergenic
1096008256 12:48189878-48189900 TACTCCTGACTTGTCTCCCCTGG + Intergenic
1097983317 12:65756361-65756383 TCCAGATGAATGGTTTCCCCTGG - Intergenic
1098432053 12:70430526-70430548 TCCTCCTGCATTGCTTCCTCTGG + Exonic
1103865924 12:124052077-124052099 TCCCCGTTAATTCTTTCCTCTGG + Intronic
1103950141 12:124545958-124545980 TACCCCTGAACTGCTGCCCCAGG - Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1108635931 13:52334187-52334209 TCCCCCTCCATGGTTTCCCCAGG - Intergenic
1108651879 13:52489061-52489083 TCCCCCTCCATGGTTTCCCCAGG + Intergenic
1112751468 13:102588174-102588196 TGCCCTTGAATTGTTTCCTGAGG - Intergenic
1118319959 14:64747244-64747266 TCTCCCTCAACTGTTTCCCTGGG - Exonic
1119303285 14:73587746-73587768 CTCCCCTGACTTGTTTCCACGGG + Intergenic
1119516028 14:75249109-75249131 TCCCTCTGAACTTTTTCACCTGG - Intronic
1124400747 15:29345539-29345561 TTCCCCCTAATTGTTTCCTCTGG - Intronic
1133404938 16:5516022-5516044 TCCCTCTCAACTGTTTCCCAAGG + Intergenic
1134809971 16:17158909-17158931 TCCCCTTGGTTTGTTTCCACAGG - Exonic
1136020068 16:27434474-27434496 GCACCCTGAATTGCATCCCCGGG - Intronic
1137540832 16:49360504-49360526 TCCCCCTGCACTGGTCCCCCTGG + Intergenic
1137739334 16:50751754-50751776 TCGACCTGCATTGTGTCCCCAGG - Exonic
1140717518 16:77739978-77740000 TTCCCCTTAACTGTTTCCCCTGG + Intronic
1144196708 17:12901673-12901695 TCACCCTGCATTTTCTCCCCAGG - Intronic
1148937146 17:51172547-51172569 TACCCCTTAATTTTTTTCCCTGG + Intergenic
1158890876 18:61870771-61870793 TTCCCCTGAACTGTTTTGCCTGG - Intronic
1163629821 19:18412567-18412589 ACTCCCTGATTTGTGTCCCCAGG + Intergenic
1164147335 19:22520014-22520036 TTCCACAGAATTGTTTCCCCAGG + Intronic
1164159263 19:22616096-22616118 TTCCAAGGAATTGTTTCCCCAGG - Intergenic
1166407114 19:42529088-42529110 TCCCCCTGAAGTCTTCCCCAAGG - Intronic
1166640662 19:44492545-44492567 TCCCCCTGCTTTGGTTCCCATGG - Intronic
1166782391 19:45349399-45349421 TCCCTCTGACTTGTGACCCCTGG + Intronic
1168465412 19:56597368-56597390 TTCCTTTGAATTGTTTCCCTGGG - Intronic
1168516349 19:57013133-57013155 GCCCCCTGGATGGTATCCCCTGG - Intergenic
1168516389 19:57013243-57013265 GCCCCCTGGATGGTATCCCCTGG - Intergenic
1168516419 19:57013327-57013349 ACCCCCTGGATGGTATCCCCTGG - Intergenic
1168516430 19:57013355-57013377 GCCCCCTGGATGGTATCCCCTGG - Intergenic
925012952 2:499753-499775 TTCCCTTGCATTGTTTCCTCTGG + Intergenic
932618836 2:73253958-73253980 TGCCCCTGACTTGATTCCTCAGG - Intergenic
937582458 2:123503475-123503497 TCTCCCTGAAGTAATTCCCCTGG + Intergenic
939960262 2:148559935-148559957 TCCCCCTGAAGTGCTTCTCCAGG + Intergenic
945547476 2:211174376-211174398 TCCCACTGAACTGTATCCCATGG + Intergenic
947309061 2:228780476-228780498 TCCCCAAGAAGTGGTTCCCCAGG + Intergenic
948327327 2:237136069-237136091 ATCCCCTGTACTGTTTCCCCTGG - Intergenic
1169076125 20:2760666-2760688 TCCCCCTGAGATATGTCCCCTGG + Intergenic
1169281046 20:4267190-4267212 TCTACCTGCATTATTTCCCCAGG - Intergenic
1170842437 20:19934918-19934940 TCCCCCTTTATTTTTTCCTCTGG + Intronic
1171069809 20:22057705-22057727 TCAACTTGAATTGTTTCTCCTGG + Intergenic
1171447074 20:25212459-25212481 TCCCCCTGCCATGTTTCACCTGG + Intronic
1177585245 21:23084747-23084769 TTCACCTCAATTATTTCCCCAGG + Intergenic
1177863034 21:26477802-26477824 TACCTCTGAATTTTTTCCCTTGG - Intronic
1179406798 21:41132809-41132831 TGCCCCTGATTTTCTTCCCCAGG - Intergenic
1180192300 21:46171473-46171495 TCCCTCTGAAATGTTTTCCAAGG + Intronic
1184167529 22:42739099-42739121 TCGCCCTGAATTCTTTCTTCCGG + Intergenic
950366246 3:12486397-12486419 TCCTCTTGAATTTTTCCCCCTGG + Intronic
953808191 3:46089715-46089737 TCTCCATGAATTGTTTCTCTGGG + Intergenic
956783026 3:72619294-72619316 TTCCCTTGAATTCATTCCCCGGG - Intergenic
958561510 3:95753452-95753474 TCCCCCTGAACTTATTCTCCTGG - Intergenic
959834954 3:110907109-110907131 TCTCCCTTGATTGTTGCCCCAGG + Intergenic
962989506 3:140565487-140565509 ACCCCCTGACTTGTGTCCTCAGG - Intronic
964684472 3:159379767-159379789 TCCCACCCAACTGTTTCCCCAGG - Intronic
964714912 3:159711894-159711916 TCCCCCTGAACCGTTTGCTCTGG + Intronic
965046817 3:163588859-163588881 ACCCCCTGTATTTTTTTCCCTGG + Intergenic
965376916 3:167936243-167936265 TCCCTCTGGTTTCTTTCCCCTGG - Intergenic
968011995 3:195288504-195288526 TTCCCCTGAATATTTTCCACTGG - Intronic
968750026 4:2383988-2384010 TCACCCTGAAGTGTCTCCACTGG + Intronic
969437911 4:7199265-7199287 TCCTCCTGAATTGCATCCCTGGG - Intronic
980963739 4:139500971-139500993 TCAGCCTGAAATGTTTCCCCTGG + Intronic
981186696 4:141811948-141811970 TCCGACTGAATTATTTTCCCTGG + Intergenic
982017127 4:151165791-151165813 TATCCATGAATAGTTTCCCCAGG - Intronic
986785449 5:11110305-11110327 TTCACCTGAATTGTTCCCCACGG + Intronic
987303297 5:16616568-16616590 TCCCCCTGCACTGGGTCCCCGGG + Intronic
988783260 5:34542765-34542787 TCCACCTGAATTATCTGCCCAGG + Intergenic
991237329 5:64414692-64414714 TCCCACTGAAGTGTTTTCCCAGG - Intergenic
998265184 5:140662749-140662771 TCCCCAGGAAATCTTTCCCCAGG - Intergenic
999282463 5:150374595-150374617 TCCCCTTGTCTTGTTTCTCCAGG + Exonic
1007513323 6:42391441-42391463 TCTCCCAGAATTGTTCCCCCCGG - Intronic
1007706901 6:43796612-43796634 TCCCAGAGAATTGTTTCCACTGG - Intergenic
1011133440 6:84074879-84074901 TTCCCCTGAATTTTTTGACCTGG + Intronic
1011265426 6:85512653-85512675 ACCCCATGACTTGGTTCCCCTGG + Intronic
1013152419 6:107459331-107459353 TGCCCCTGGTTTGTTTCCCGCGG - Exonic
1018512461 6:164540117-164540139 TTTCCCTGAATCCTTTCCCCTGG - Intergenic
1018542765 6:164900728-164900750 TCTCCATGAAGTGTTTCCACTGG + Intergenic
1022250978 7:28608234-28608256 TCCCCCTGATATGTATCCACAGG + Intronic
1023494406 7:40779021-40779043 TCTGCCTGATCTGTTTCCCCAGG - Intronic
1028511051 7:91626656-91626678 TCCTTCTGATTTTTTTCCCCAGG - Intergenic
1032085643 7:128882081-128882103 TCCCCATGCACTGTGTCCCCAGG + Intronic
1032727067 7:134600191-134600213 TCCCCCTGAGTTCTTTGCCTAGG + Intergenic
1033272782 7:139947666-139947688 TTCCCCTGAATGGTTACCACTGG + Intronic
1036663865 8:10726274-10726296 ACCTCCTGAAATGTCTCCCCTGG - Exonic
1043380311 8:79695483-79695505 TCCTCCTGAATTCTTACCCTCGG + Intergenic
1045501811 8:102749233-102749255 TCCCGCTGGCTTCTTTCCCCAGG - Intergenic
1050027902 9:1354837-1354859 TCCCCATGAATTCTTTCCAGCGG + Intergenic
1052777293 9:32744946-32744968 TCCCCCTTAATTCTATCCTCTGG - Intergenic
1056323411 9:85457865-85457887 TGCTCCTACATTGTTTCCCCAGG - Intergenic
1056445012 9:86656951-86656973 TGTCCCTGAATTCTTTCTCCAGG - Intergenic
1056809749 9:89755003-89755025 TCACCCTGACTTCTTGCCCCTGG + Intergenic
1057798165 9:98172750-98172772 TCCACCTAAATTGTTTGTCCAGG + Exonic
1059030451 9:110687842-110687864 CCACCCTGAATTCTTTCACCAGG + Intronic
1059412627 9:114142487-114142509 TTTCCCTTCATTGTTTCCCCAGG + Intergenic
1059601873 9:115787515-115787537 TTCCCCTGAATTGCTAACCCTGG - Intergenic
1060014324 9:120073401-120073423 TCCCCCTGATTCTTTTCCTCTGG - Intergenic
1060246585 9:121951713-121951735 TCGCCCTGAATTCTTTCCTGCGG - Intronic
1185857663 X:3550899-3550921 TCACCCTGAAATGTTTTCCTGGG + Intergenic
1186243532 X:7595257-7595279 TGCCCCTGCATTGCTTCCTCTGG - Intergenic
1187698893 X:21946172-21946194 GCCCCCTGAATTGTATCCATTGG + Intronic
1187724427 X:22187683-22187705 TCCCCTTCACTTGTTTCCTCAGG + Intronic
1188249294 X:27873149-27873171 TCTCCCTGTATTGTTTCTCATGG - Intergenic
1189752947 X:44241225-44241247 TTCCCCTGACTTCTTTCTCCAGG + Intronic
1191678194 X:63814189-63814211 TCCCACTGAATCCTGTCCCCAGG + Intergenic
1194623068 X:96196784-96196806 TCCCCCCGAGTTCTTTCCCAGGG - Intergenic
1201759168 Y:17518876-17518898 TGCCCCTGAATTGCAGCCCCTGG - Intergenic
1201842387 Y:18387114-18387136 TGCCCCTGAATTGCAGCCCCTGG + Intergenic