ID: 910709100

View in Genome Browser
Species Human (GRCh38)
Location 1:90160179-90160201
Sequence AGTCACTTGGGGCATAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910709096_910709100 -10 Left 910709096 1:90160166-90160188 CCACAACTGACAAAGTCACTTGG No data
Right 910709100 1:90160179-90160201 AGTCACTTGGGGCATAGAACAGG No data
910709093_910709100 20 Left 910709093 1:90160136-90160158 CCAGAGAGTTAGGAAACTGGTGG No data
Right 910709100 1:90160179-90160201 AGTCACTTGGGGCATAGAACAGG No data
910709091_910709100 27 Left 910709091 1:90160129-90160151 CCAAAAACCAGAGAGTTAGGAAA No data
Right 910709100 1:90160179-90160201 AGTCACTTGGGGCATAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910709100 Original CRISPR AGTCACTTGGGGCATAGAAC AGG Intergenic
No off target data available for this crispr