ID: 910712328

View in Genome Browser
Species Human (GRCh38)
Location 1:90194640-90194662
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910712326_910712328 6 Left 910712326 1:90194611-90194633 CCTCACAGAAAGTAGCATAAAAC No data
Right 910712328 1:90194640-90194662 TATGATAGCATATAAGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr