ID: 910712458

View in Genome Browser
Species Human (GRCh38)
Location 1:90195982-90196004
Sequence TCCCTGCCTTGGTTTCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910712450_910712458 30 Left 910712450 1:90195929-90195951 CCCTAGTTTCCTTTTCAGCTCTT No data
Right 910712458 1:90195982-90196004 TCCCTGCCTTGGTTTCATGAAGG No data
910712453_910712458 7 Left 910712453 1:90195952-90195974 CCTTTGCTTCATAGTATTCTACC No data
Right 910712458 1:90195982-90196004 TCCCTGCCTTGGTTTCATGAAGG No data
910712451_910712458 29 Left 910712451 1:90195930-90195952 CCTAGTTTCCTTTTCAGCTCTTC No data
Right 910712458 1:90195982-90196004 TCCCTGCCTTGGTTTCATGAAGG No data
910712452_910712458 21 Left 910712452 1:90195938-90195960 CCTTTTCAGCTCTTCCTTTGCTT No data
Right 910712458 1:90195982-90196004 TCCCTGCCTTGGTTTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910712458 Original CRISPR TCCCTGCCTTGGTTTCATGA AGG Intergenic