ID: 910716338

View in Genome Browser
Species Human (GRCh38)
Location 1:90235696-90235718
Sequence CTATGTCTGTGGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910716338_910716354 29 Left 910716338 1:90235696-90235718 CCCTCCACTTTCCACAGACATAG No data
Right 910716354 1:90235748-90235770 TGGTCCACGAGGGATGTGCCAGG No data
910716338_910716347 9 Left 910716338 1:90235696-90235718 CCCTCCACTTTCCACAGACATAG No data
Right 910716347 1:90235728-90235750 CCTGTGGCCACCACCACCACTGG No data
910716338_910716351 19 Left 910716338 1:90235696-90235718 CCCTCCACTTTCCACAGACATAG No data
Right 910716351 1:90235738-90235760 CCACCACCACTGGTCCACGAGGG No data
910716338_910716349 18 Left 910716338 1:90235696-90235718 CCCTCCACTTTCCACAGACATAG No data
Right 910716349 1:90235737-90235759 ACCACCACCACTGGTCCACGAGG No data
910716338_910716343 -7 Left 910716338 1:90235696-90235718 CCCTCCACTTTCCACAGACATAG No data
Right 910716343 1:90235712-90235734 GACATAGGAGCCTCTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910716338 Original CRISPR CTATGTCTGTGGAAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr