ID: 910720448

View in Genome Browser
Species Human (GRCh38)
Location 1:90280475-90280497
Sequence TAGCCTGTGACTGCTGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910720448_910720449 -7 Left 910720448 1:90280475-90280497 CCAGTCACAGCAGTCACAGGCTA No data
Right 910720449 1:90280491-90280513 CAGGCTAGCACAGATTCAATAGG No data
910720448_910720452 25 Left 910720448 1:90280475-90280497 CCAGTCACAGCAGTCACAGGCTA No data
Right 910720452 1:90280523-90280545 CATACTCCACCTCCAGATGGAGG No data
910720448_910720451 22 Left 910720448 1:90280475-90280497 CCAGTCACAGCAGTCACAGGCTA No data
Right 910720451 1:90280520-90280542 AAACATACTCCACCTCCAGATGG No data
910720448_910720450 -6 Left 910720448 1:90280475-90280497 CCAGTCACAGCAGTCACAGGCTA No data
Right 910720450 1:90280492-90280514 AGGCTAGCACAGATTCAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910720448 Original CRISPR TAGCCTGTGACTGCTGTGAC TGG (reversed) Intergenic
No off target data available for this crispr