ID: 910723121

View in Genome Browser
Species Human (GRCh38)
Location 1:90309511-90309533
Sequence GTGGTTTACCAGGTTTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910723115_910723121 12 Left 910723115 1:90309476-90309498 CCTCTGGAAACACCCTCACAGAC 0: 64
1: 290
2: 1680
3: 1614
4: 1145
Right 910723121 1:90309511-90309533 GTGGTTTACCAGGTTTCTCTAGG No data
910723117_910723121 -1 Left 910723117 1:90309489-90309511 CCTCACAGACACATCCAAAATAG No data
Right 910723121 1:90309511-90309533 GTGGTTTACCAGGTTTCTCTAGG No data
910723116_910723121 0 Left 910723116 1:90309488-90309510 CCCTCACAGACACATCCAAAATA No data
Right 910723121 1:90309511-90309533 GTGGTTTACCAGGTTTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910723121 Original CRISPR GTGGTTTACCAGGTTTCTCT AGG Intergenic
No off target data available for this crispr