ID: 910723379

View in Genome Browser
Species Human (GRCh38)
Location 1:90312260-90312282
Sequence GAACTCAGCTTCTTGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910723377_910723379 6 Left 910723377 1:90312231-90312253 CCAAAATTCAAATTTTTAATTGA No data
Right 910723379 1:90312260-90312282 GAACTCAGCTTCTTGGAAACTGG No data
910723376_910723379 17 Left 910723376 1:90312220-90312242 CCTACTCTGTGCCAAAATTCAAA No data
Right 910723379 1:90312260-90312282 GAACTCAGCTTCTTGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910723379 Original CRISPR GAACTCAGCTTCTTGGAAAC TGG Intergenic
No off target data available for this crispr