ID: 910724297

View in Genome Browser
Species Human (GRCh38)
Location 1:90322498-90322520
Sequence ATGGATTGGTAGAGAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910724294_910724297 -4 Left 910724294 1:90322479-90322501 CCAGATTTTGAAGGAGATGATGG No data
Right 910724297 1:90322498-90322520 ATGGATTGGTAGAGAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910724297 Original CRISPR ATGGATTGGTAGAGAGAAGA TGG Intergenic
No off target data available for this crispr