ID: 910727368

View in Genome Browser
Species Human (GRCh38)
Location 1:90353101-90353123
Sequence GTGACCTATAGAAGGCCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910727359_910727368 17 Left 910727359 1:90353061-90353083 CCTGGACCCTTTTTGGGGGATGG No data
Right 910727368 1:90353101-90353123 GTGACCTATAGAAGGCCTATAGG No data
910727363_910727368 10 Left 910727363 1:90353068-90353090 CCTTTTTGGGGGATGGTATAGGT No data
Right 910727368 1:90353101-90353123 GTGACCTATAGAAGGCCTATAGG No data
910727361_910727368 11 Left 910727361 1:90353067-90353089 CCCTTTTTGGGGGATGGTATAGG No data
Right 910727368 1:90353101-90353123 GTGACCTATAGAAGGCCTATAGG No data
910727354_910727368 25 Left 910727354 1:90353053-90353075 CCTGATTTCCTGGACCCTTTTTG No data
Right 910727368 1:90353101-90353123 GTGACCTATAGAAGGCCTATAGG No data
910727353_910727368 28 Left 910727353 1:90353050-90353072 CCACCTGATTTCCTGGACCCTTT No data
Right 910727368 1:90353101-90353123 GTGACCTATAGAAGGCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910727368 Original CRISPR GTGACCTATAGAAGGCCTAT AGG Intergenic
No off target data available for this crispr