ID: 910731035

View in Genome Browser
Species Human (GRCh38)
Location 1:90396783-90396805
Sequence GTATTGGCATAAAATGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910731035_910731038 6 Left 910731035 1:90396783-90396805 CCATTGGCATTTTATGCCAATAC No data
Right 910731038 1:90396812-90396834 ATTCTAATTACAGTGGCTCTAGG No data
910731035_910731039 7 Left 910731035 1:90396783-90396805 CCATTGGCATTTTATGCCAATAC No data
Right 910731039 1:90396813-90396835 TTCTAATTACAGTGGCTCTAGGG No data
910731035_910731037 -1 Left 910731035 1:90396783-90396805 CCATTGGCATTTTATGCCAATAC No data
Right 910731037 1:90396805-90396827 CTATATTATTCTAATTACAGTGG No data
910731035_910731040 8 Left 910731035 1:90396783-90396805 CCATTGGCATTTTATGCCAATAC No data
Right 910731040 1:90396814-90396836 TCTAATTACAGTGGCTCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910731035 Original CRISPR GTATTGGCATAAAATGCCAA TGG (reversed) Intergenic
No off target data available for this crispr