ID: 910731039

View in Genome Browser
Species Human (GRCh38)
Location 1:90396813-90396835
Sequence TTCTAATTACAGTGGCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910731036_910731039 -9 Left 910731036 1:90396799-90396821 CCAATACTATATTATTCTAATTA No data
Right 910731039 1:90396813-90396835 TTCTAATTACAGTGGCTCTAGGG No data
910731035_910731039 7 Left 910731035 1:90396783-90396805 CCATTGGCATTTTATGCCAATAC No data
Right 910731039 1:90396813-90396835 TTCTAATTACAGTGGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910731039 Original CRISPR TTCTAATTACAGTGGCTCTA GGG Intergenic
No off target data available for this crispr