ID: 910734282

View in Genome Browser
Species Human (GRCh38)
Location 1:90435038-90435060
Sequence GCCTCCTTAAAGCTACCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910734282_910734288 30 Left 910734282 1:90435038-90435060 CCTTAGGGTAGCTTTAAGGAGGC No data
Right 910734288 1:90435091-90435113 GTTTCCAGGATTTTTCTCTCTGG No data
910734282_910734286 1 Left 910734282 1:90435038-90435060 CCTTAGGGTAGCTTTAAGGAGGC No data
Right 910734286 1:90435062-90435084 GGATGGAAGCTGAAACTTGAAGG No data
910734282_910734287 16 Left 910734282 1:90435038-90435060 CCTTAGGGTAGCTTTAAGGAGGC No data
Right 910734287 1:90435077-90435099 CTTGAAGGATGAATGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910734282 Original CRISPR GCCTCCTTAAAGCTACCCTA AGG (reversed) Intergenic
No off target data available for this crispr