ID: 910738955

View in Genome Browser
Species Human (GRCh38)
Location 1:90494522-90494544
Sequence TTACCACAGCTGATGCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910738955_910738958 -7 Left 910738955 1:90494522-90494544 CCAGAGAGCATCAGCTGTGGTAA No data
Right 910738958 1:90494538-90494560 GTGGTAATATGGAGAGGAACTGG No data
910738955_910738959 -1 Left 910738955 1:90494522-90494544 CCAGAGAGCATCAGCTGTGGTAA No data
Right 910738959 1:90494544-90494566 ATATGGAGAGGAACTGGCAATGG No data
910738955_910738960 0 Left 910738955 1:90494522-90494544 CCAGAGAGCATCAGCTGTGGTAA No data
Right 910738960 1:90494545-90494567 TATGGAGAGGAACTGGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910738955 Original CRISPR TTACCACAGCTGATGCTCTC TGG (reversed) Intergenic
No off target data available for this crispr