ID: 910742672

View in Genome Browser
Species Human (GRCh38)
Location 1:90537439-90537461
Sequence GTGTGGTTGCTGAATGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910742672_910742676 22 Left 910742672 1:90537439-90537461 CCTGCTTCATTCAGCAACCACAC No data
Right 910742676 1:90537484-90537506 CCAGAGCAGTTAAAATTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910742672 Original CRISPR GTGTGGTTGCTGAATGAAGC AGG (reversed) Intergenic
No off target data available for this crispr