ID: 910744954

View in Genome Browser
Species Human (GRCh38)
Location 1:90563432-90563454
Sequence CCTTTCAGGCATGCACTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910744954_910744958 20 Left 910744954 1:90563432-90563454 CCTTTTAGTGCATGCCTGAAAGG No data
Right 910744958 1:90563475-90563497 AAAATTAAATAGATAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910744954 Original CRISPR CCTTTCAGGCATGCACTAAA AGG (reversed) Intergenic
No off target data available for this crispr