ID: 910746607

View in Genome Browser
Species Human (GRCh38)
Location 1:90581582-90581604
Sequence AGGGTTGTTCCTGCCTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910746607_910746611 8 Left 910746607 1:90581582-90581604 CCATCATAGGCAGGAACAACCCT No data
Right 910746611 1:90581613-90581635 TGCACCCATCAGAGTGTCTCAGG No data
910746607_910746615 28 Left 910746607 1:90581582-90581604 CCATCATAGGCAGGAACAACCCT No data
Right 910746615 1:90581633-90581655 AGGCCATGGAATAATAATACTGG No data
910746607_910746614 14 Left 910746607 1:90581582-90581604 CCATCATAGGCAGGAACAACCCT No data
Right 910746614 1:90581619-90581641 CATCAGAGTGTCTCAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910746607 Original CRISPR AGGGTTGTTCCTGCCTATGA TGG (reversed) Intergenic
No off target data available for this crispr