ID: 910749237

View in Genome Browser
Species Human (GRCh38)
Location 1:90610444-90610466
Sequence AAAAAAAACTTTTTAGCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910749237_910749242 2 Left 910749237 1:90610444-90610466 CCCCTAGCTAAAAAGTTTTTTTT No data
Right 910749242 1:90610469-90610491 TTACCCTAGGCTTGGAGCATTGG No data
910749237_910749241 -6 Left 910749237 1:90610444-90610466 CCCCTAGCTAAAAAGTTTTTTTT No data
Right 910749241 1:90610461-90610483 TTTTTTTTTTACCCTAGGCTTGG No data
910749237_910749246 28 Left 910749237 1:90610444-90610466 CCCCTAGCTAAAAAGTTTTTTTT No data
Right 910749246 1:90610495-90610517 AATTATTTGCCAAAGATAGCGGG No data
910749237_910749245 27 Left 910749237 1:90610444-90610466 CCCCTAGCTAAAAAGTTTTTTTT No data
Right 910749245 1:90610494-90610516 AAATTATTTGCCAAAGATAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910749237 Original CRISPR AAAAAAAACTTTTTAGCTAG GGG (reversed) Intergenic
No off target data available for this crispr