ID: 910749244

View in Genome Browser
Species Human (GRCh38)
Location 1:90610473-90610495
Sequence TTTGCCAATGCTCCAAGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910749244_910749246 -1 Left 910749244 1:90610473-90610495 CCTAGGCTTGGAGCATTGGCAAA No data
Right 910749246 1:90610495-90610517 AATTATTTGCCAAAGATAGCGGG No data
910749244_910749247 4 Left 910749244 1:90610473-90610495 CCTAGGCTTGGAGCATTGGCAAA No data
Right 910749247 1:90610500-90610522 TTTGCCAAAGATAGCGGGATTGG No data
910749244_910749251 16 Left 910749244 1:90610473-90610495 CCTAGGCTTGGAGCATTGGCAAA No data
Right 910749251 1:90610512-90610534 AGCGGGATTGGGATATTGGAAGG No data
910749244_910749245 -2 Left 910749244 1:90610473-90610495 CCTAGGCTTGGAGCATTGGCAAA No data
Right 910749245 1:90610494-90610516 AAATTATTTGCCAAAGATAGCGG No data
910749244_910749250 12 Left 910749244 1:90610473-90610495 CCTAGGCTTGGAGCATTGGCAAA No data
Right 910749250 1:90610508-90610530 AGATAGCGGGATTGGGATATTGG No data
910749244_910749248 5 Left 910749244 1:90610473-90610495 CCTAGGCTTGGAGCATTGGCAAA No data
Right 910749248 1:90610501-90610523 TTGCCAAAGATAGCGGGATTGGG No data
910749244_910749252 17 Left 910749244 1:90610473-90610495 CCTAGGCTTGGAGCATTGGCAAA No data
Right 910749252 1:90610513-90610535 GCGGGATTGGGATATTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910749244 Original CRISPR TTTGCCAATGCTCCAAGCCT AGG (reversed) Intergenic
No off target data available for this crispr