ID: 910749245

View in Genome Browser
Species Human (GRCh38)
Location 1:90610494-90610516
Sequence AAATTATTTGCCAAAGATAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910749243_910749245 -1 Left 910749243 1:90610472-90610494 CCCTAGGCTTGGAGCATTGGCAA No data
Right 910749245 1:90610494-90610516 AAATTATTTGCCAAAGATAGCGG No data
910749238_910749245 26 Left 910749238 1:90610445-90610467 CCCTAGCTAAAAAGTTTTTTTTT No data
Right 910749245 1:90610494-90610516 AAATTATTTGCCAAAGATAGCGG No data
910749244_910749245 -2 Left 910749244 1:90610473-90610495 CCTAGGCTTGGAGCATTGGCAAA No data
Right 910749245 1:90610494-90610516 AAATTATTTGCCAAAGATAGCGG No data
910749239_910749245 25 Left 910749239 1:90610446-90610468 CCTAGCTAAAAAGTTTTTTTTTT No data
Right 910749245 1:90610494-90610516 AAATTATTTGCCAAAGATAGCGG No data
910749237_910749245 27 Left 910749237 1:90610444-90610466 CCCCTAGCTAAAAAGTTTTTTTT No data
Right 910749245 1:90610494-90610516 AAATTATTTGCCAAAGATAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910749245 Original CRISPR AAATTATTTGCCAAAGATAG CGG Intergenic
No off target data available for this crispr