ID: 910749246

View in Genome Browser
Species Human (GRCh38)
Location 1:90610495-90610517
Sequence AATTATTTGCCAAAGATAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910749237_910749246 28 Left 910749237 1:90610444-90610466 CCCCTAGCTAAAAAGTTTTTTTT No data
Right 910749246 1:90610495-90610517 AATTATTTGCCAAAGATAGCGGG No data
910749239_910749246 26 Left 910749239 1:90610446-90610468 CCTAGCTAAAAAGTTTTTTTTTT No data
Right 910749246 1:90610495-90610517 AATTATTTGCCAAAGATAGCGGG No data
910749238_910749246 27 Left 910749238 1:90610445-90610467 CCCTAGCTAAAAAGTTTTTTTTT No data
Right 910749246 1:90610495-90610517 AATTATTTGCCAAAGATAGCGGG No data
910749244_910749246 -1 Left 910749244 1:90610473-90610495 CCTAGGCTTGGAGCATTGGCAAA No data
Right 910749246 1:90610495-90610517 AATTATTTGCCAAAGATAGCGGG No data
910749243_910749246 0 Left 910749243 1:90610472-90610494 CCCTAGGCTTGGAGCATTGGCAA No data
Right 910749246 1:90610495-90610517 AATTATTTGCCAAAGATAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910749246 Original CRISPR AATTATTTGCCAAAGATAGC GGG Intergenic
No off target data available for this crispr