ID: 910749251

View in Genome Browser
Species Human (GRCh38)
Location 1:90610512-90610534
Sequence AGCGGGATTGGGATATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910749243_910749251 17 Left 910749243 1:90610472-90610494 CCCTAGGCTTGGAGCATTGGCAA No data
Right 910749251 1:90610512-90610534 AGCGGGATTGGGATATTGGAAGG No data
910749244_910749251 16 Left 910749244 1:90610473-90610495 CCTAGGCTTGGAGCATTGGCAAA No data
Right 910749251 1:90610512-90610534 AGCGGGATTGGGATATTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910749251 Original CRISPR AGCGGGATTGGGATATTGGA AGG Intergenic
No off target data available for this crispr