ID: 910759282

View in Genome Browser
Species Human (GRCh38)
Location 1:90718822-90718844
Sequence GGCTCAGGACCCATAGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910759273_910759282 9 Left 910759273 1:90718790-90718812 CCACGGTTCACTGCGGTGTCGGG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 910759282 1:90718822-90718844 GGCTCAGGACCCATAGCGGCTGG 0: 1
1: 0
2: 1
3: 4
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910759282 Original CRISPR GGCTCAGGACCCATAGCGGC TGG Intergenic
900937183 1:5773799-5773821 GGCCCAGGACAGAGAGCGGCCGG - Intergenic
901600425 1:10419410-10419432 TGCTCAGGACTCCTGGCGGCGGG + Exonic
903295481 1:22340717-22340739 GGCTCTGGAGCCACAGCGCCTGG - Intergenic
903539053 1:24086576-24086598 GGCTCAGGACCTGAAGCTGCAGG - Intronic
907492089 1:54814793-54814815 GGCTCAAGACCCAGGGCTGCTGG + Intronic
910759282 1:90718822-90718844 GGCTCAGGACCCATAGCGGCTGG + Intergenic
912744178 1:112231446-112231468 GCCTCAGGACCCATATGGGTAGG + Intergenic
922183808 1:223256859-223256881 GGCTCAGGAGGCACAGGGGCCGG + Intronic
1064003347 10:11681639-11681661 GGCTCAGAACTTACAGCGGCAGG - Intergenic
1066129666 10:32380409-32380431 GGCCCAGGCCCCATGGCGGTAGG - Intergenic
1067810010 10:49418762-49418784 GCCTCAGCACCCATAGCTGAGGG + Intergenic
1069558654 10:69414289-69414311 TGCTCAGGCCACAAAGCGGCAGG - Intronic
1073999769 10:109359042-109359064 GGCTGAGGACCCATGGCCTCTGG + Intergenic
1074290725 10:112136546-112136568 GGCCGAGGACCCAGAGCTGCTGG - Intergenic
1076029440 10:127145139-127145161 GGCTCAGGACCCAGAGCCGCAGG - Intronic
1076302987 10:129441894-129441916 GGAGCAGGACCCAGAGTGGCTGG + Intergenic
1076829057 10:132985206-132985228 GGCTCTGGTCCCATCTCGGCAGG + Intergenic
1081782990 11:45726415-45726437 GGCTCAGGACACATCTAGGCTGG + Intergenic
1084275760 11:68050220-68050242 GGCTCAGGGCCCACAGGCGCAGG - Exonic
1085059456 11:73431225-73431247 GCCTCAGTCCCCATAGCAGCTGG - Intronic
1096503744 12:52080600-52080622 GGCCTAGGACCTATAGGGGCTGG - Intergenic
1103728573 12:123011412-123011434 GACTTAGGACCCATGGCAGCTGG + Intronic
1105792956 13:23820737-23820759 GGCTCAGGCACCAGAGCGGCAGG - Intronic
1110369850 13:74727706-74727728 GCCTCAGGATCCATAGCTGTGGG - Intergenic
1113904381 13:113812586-113812608 GTCTCAGGACCCCTGGCCGCTGG + Exonic
1117704359 14:58448037-58448059 GGCTCAGGGGCCATTGCAGCCGG - Intronic
1118791130 14:69094156-69094178 GCCTCACCACCCATAGCAGCAGG + Intronic
1119320310 14:73726517-73726539 TGCTCAGGACCTATGGCTGCTGG - Intronic
1122403046 14:101478791-101478813 GGCTCAGGACAAATAGCGTGGGG - Intergenic
1133552147 16:6866916-6866938 AGCTAAGGACCCATAAGGGCTGG - Intronic
1135238220 16:20778617-20778639 GGCTCAGCACCCATACTGCCTGG - Intronic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1141726466 16:85792510-85792532 GCCTCAGCACTCACAGCGGCAGG + Intronic
1144489560 17:15696884-15696906 CGCTCAGGGTCCATAGCTGCTGG + Intergenic
1144827786 17:18116117-18116139 GGCTCAGGACCCTTAGGGAAAGG + Intronic
1144911408 17:18685073-18685095 CGCTCAGGCTCCATAGCTGCTGG - Intergenic
1146142410 17:30379253-30379275 GGCGAAGCACCCACAGCGGCCGG - Exonic
1146290206 17:31601267-31601289 GGGTCAGGAGCCAAGGCGGCAGG + Intergenic
1152914757 17:83028135-83028157 GGCTCTGGTCCCATGGCAGCCGG + Intronic
1155219429 18:23671084-23671106 TGCTGGGGACCCATAGTGGCAGG - Intergenic
1160261579 18:77299236-77299258 GGGTCAGGACCCTGAGCAGCAGG + Intergenic
1161017635 19:1991151-1991173 GGCCCAGGACCCCGAGTGGCAGG + Intronic
1161304074 19:3557378-3557400 GGCCCGGGACCCCCAGCGGCCGG - Exonic
1162258208 19:9510393-9510415 GGCTCATGGCCCATACCGGAGGG + Intergenic
1162869771 19:13576992-13577014 GGCTCAGGAGCCACAGTGCCTGG - Intronic
1163729554 19:18941221-18941243 GCCTCCGGTCCCATCGCGGCCGG + Intronic
1163763441 19:19149433-19149455 GACCCAGGACCCACAGGGGCAGG + Intronic
930160771 2:48154411-48154433 GGCTTAGGGCACACAGCGGCAGG + Intergenic
932779883 2:74553485-74553507 GGCTGAGGAGCCATAGCGCCTGG - Intronic
934587699 2:95517993-95518015 GCCTCAGGACCCTCAGCAGCAGG + Intergenic
935678670 2:105617789-105617811 GATTCAGGACCCAGAACGGCGGG - Intergenic
942004073 2:171679981-171680003 AGCTCAGAGCCCATAGCTGCAGG - Intergenic
948349035 2:237323084-237323106 GGCCCAGCTCCCATAGCGGTGGG - Intergenic
1168966774 20:1903489-1903511 GGCTCTTCACCCATAGCAGCTGG + Intronic
1169296402 20:4403607-4403629 GGCTCAGGACCTGCAGCGGATGG + Intergenic
1169969556 20:11254780-11254802 GGCTCAGAACCCACAGCATCTGG - Intergenic
1170457187 20:16544222-16544244 GGCCCAGGACTCACAGAGGCGGG - Intronic
1172293806 20:33793803-33793825 GGCTAAGAACCCATGGAGGCAGG - Intergenic
1173009110 20:39165293-39165315 GGCTCTGGCCCCAAAGGGGCTGG + Intergenic
1173707546 20:45123781-45123803 GTCTCAGGACCCTCAGGGGCAGG + Exonic
1174763211 20:53227142-53227164 GGCTCAGGACACCGAGAGGCTGG - Intronic
1176431649 21:6579745-6579767 GGCACAAGACCCATAACAGCAGG - Intergenic
1179707043 21:43187207-43187229 GGCACAAGACCCATAACAGCAGG - Intergenic
1180233591 21:46443046-46443068 GGCTCTTGTCCCAGAGCGGCAGG + Intronic
1181019242 22:20090135-20090157 GGGTCAGCACCCATAGAGTCAGG - Exonic
1182162240 22:28134133-28134155 CACTCAGGACCCTTAGCTGCAGG - Intronic
1184851992 22:47126350-47126372 GGCTCAGGAACCACAGGGGAAGG - Intronic
950096669 3:10334697-10334719 TGTCCACGACCCATAGCGGCAGG - Intronic
951803661 3:26623615-26623637 GCCTCAGGAGCCAGAGCTGCGGG - Intronic
961816795 3:129555273-129555295 GGCTCAGAGCCCATGGGGGCTGG - Exonic
961866061 3:129954390-129954412 GGTTCAGGACTCAGAGAGGCTGG - Intergenic
964644766 3:158947337-158947359 GGCTCAGGAGCCACAGCAGCAGG - Intergenic
966807247 3:183817283-183817305 GCCTCAGGACCCACTGCCGCGGG - Exonic
967978048 3:195046354-195046376 GGCTCAGGAGCCCTGGCTGCTGG - Intergenic
968092670 3:195908713-195908735 GGCTCAGGACCCGGAGGCGCCGG - Intronic
968944784 4:3658021-3658043 AGCTCAGAACACACAGCGGCCGG + Intergenic
969273997 4:6122776-6122798 GGCTCAGGAGCCAGAGTGACTGG + Intronic
969899326 4:10334083-10334105 GGCTCAGGATCCACTGCAGCAGG + Intergenic
971564210 4:28117422-28117444 GGCCCAGCACTCAGAGCGGCTGG - Intergenic
976844058 4:89466901-89466923 AGCTCAAGACCCAGAGAGGCAGG - Intergenic
985511763 5:317673-317695 GACTGAGGACCCAGAGCGGGGGG - Intronic
985522861 5:386908-386930 GCCTCAGGACCCAGAGCCTCAGG - Intronic
988292582 5:29308434-29308456 GGCTCAGGAATCATAGTGGAAGG + Intergenic
992366242 5:76093011-76093033 GGCACTGGACACATAGGGGCTGG + Intronic
998134709 5:139668529-139668551 GGCACAGGCCCCAGAACGGCAGG - Intronic
999176949 5:149638555-149638577 GGCTCAGGAGCACTAGCTGCTGG + Intergenic
1006491660 6:34392866-34392888 GGCGCAGGACGCCTAGCGGCCGG + Intronic
1007781155 6:44255579-44255601 GGCTGTGGCCCCATAGCTGCGGG + Exonic
1011198650 6:84809658-84809680 GGCTAACGACCCAGAGCTGCTGG - Intergenic
1018007039 6:159631877-159631899 GGCTCAGGACCCAGAGACCCAGG - Intergenic
1018027474 6:159817360-159817382 GGGCCAGGACCCATACAGGCAGG - Intronic
1019873954 7:3792262-3792284 GGTTCAGGACCCATGGCCTCAGG - Intronic
1020805140 7:12780468-12780490 GAAGCAGGACCCATAGTGGCAGG + Intergenic
1023975532 7:45027119-45027141 GGCTGAGGACCCGTAGAGCCCGG + Intronic
1024576265 7:50767265-50767287 GGATCAGGAGCCAGAGGGGCCGG - Intronic
1024710792 7:52012271-52012293 GGGTCAGGACCCATAGGCTCAGG + Intergenic
1026895886 7:74009911-74009933 GGCTAAGGACACACATCGGCAGG + Intergenic
1033127082 7:138715776-138715798 GGCTGAGGGCCCAGAGCCGCAGG + Exonic
1036091170 8:5667324-5667346 GTCTCAGGACCCATAAGTGCAGG - Intergenic
1037033386 8:14137067-14137089 CAGTCAGGACCCATAGCTGCAGG - Intronic
1041082117 8:54223921-54223943 AGCTCATGACCCAGAGCCGCTGG - Intergenic
1049218600 8:141418721-141418743 GACTCAGGACACATGGAGGCAGG + Intronic
1060488198 9:124062839-124062861 GGCTCAGGAGCCACCGAGGCCGG - Intergenic
1060807725 9:126588089-126588111 GGCTCAGGAGCCTTGGGGGCAGG + Intergenic
1192544006 X:71997600-71997622 GGCTCAGGGCCCATACTGCCTGG + Intergenic
1198286214 X:135194508-135194530 GGAGCAGGACCCACAGCAGCAGG - Intergenic