ID: 910760192

View in Genome Browser
Species Human (GRCh38)
Location 1:90725333-90725355
Sequence CCCTGACGGGACCTGCTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910760192_910760201 13 Left 910760192 1:90725333-90725355 CCGCAGAGCAGGTCCCGTCAGGG No data
Right 910760201 1:90725369-90725391 CCTGGTGCCAGCGGTCGGCCCGG No data
910760192_910760196 -5 Left 910760192 1:90725333-90725355 CCGCAGAGCAGGTCCCGTCAGGG No data
Right 910760196 1:90725351-90725373 CAGGGTCTTTTTCCTGTTCCTGG No data
910760192_910760202 14 Left 910760192 1:90725333-90725355 CCGCAGAGCAGGTCCCGTCAGGG No data
Right 910760202 1:90725370-90725392 CTGGTGCCAGCGGTCGGCCCGGG No data
910760192_910760199 8 Left 910760192 1:90725333-90725355 CCGCAGAGCAGGTCCCGTCAGGG No data
Right 910760199 1:90725364-90725386 CTGTTCCTGGTGCCAGCGGTCGG No data
910760192_910760197 4 Left 910760192 1:90725333-90725355 CCGCAGAGCAGGTCCCGTCAGGG No data
Right 910760197 1:90725360-90725382 TTTCCTGTTCCTGGTGCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910760192 Original CRISPR CCCTGACGGGACCTGCTCTG CGG (reversed) Intergenic