ID: 910760194

View in Genome Browser
Species Human (GRCh38)
Location 1:90725346-90725368
Sequence AACAGGAAAAAGACCCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910760194_910760202 1 Left 910760194 1:90725346-90725368 CCCGTCAGGGTCTTTTTCCTGTT No data
Right 910760202 1:90725370-90725392 CTGGTGCCAGCGGTCGGCCCGGG No data
910760194_910760205 18 Left 910760194 1:90725346-90725368 CCCGTCAGGGTCTTTTTCCTGTT No data
Right 910760205 1:90725387-90725409 CCCGGGCGCCCCGCAGACCTCGG No data
910760194_910760207 23 Left 910760194 1:90725346-90725368 CCCGTCAGGGTCTTTTTCCTGTT No data
Right 910760207 1:90725392-90725414 GCGCCCCGCAGACCTCGGCGAGG No data
910760194_910760199 -5 Left 910760194 1:90725346-90725368 CCCGTCAGGGTCTTTTTCCTGTT No data
Right 910760199 1:90725364-90725386 CTGTTCCTGGTGCCAGCGGTCGG No data
910760194_910760201 0 Left 910760194 1:90725346-90725368 CCCGTCAGGGTCTTTTTCCTGTT No data
Right 910760201 1:90725369-90725391 CCTGGTGCCAGCGGTCGGCCCGG No data
910760194_910760197 -9 Left 910760194 1:90725346-90725368 CCCGTCAGGGTCTTTTTCCTGTT No data
Right 910760197 1:90725360-90725382 TTTCCTGTTCCTGGTGCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910760194 Original CRISPR AACAGGAAAAAGACCCTGAC GGG (reversed) Intergenic