ID: 910760201

View in Genome Browser
Species Human (GRCh38)
Location 1:90725369-90725391
Sequence CCTGGTGCCAGCGGTCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910760195_910760201 -1 Left 910760195 1:90725347-90725369 CCGTCAGGGTCTTTTTCCTGTTC No data
Right 910760201 1:90725369-90725391 CCTGGTGCCAGCGGTCGGCCCGG No data
910760192_910760201 13 Left 910760192 1:90725333-90725355 CCGCAGAGCAGGTCCCGTCAGGG No data
Right 910760201 1:90725369-90725391 CCTGGTGCCAGCGGTCGGCCCGG No data
910760194_910760201 0 Left 910760194 1:90725346-90725368 CCCGTCAGGGTCTTTTTCCTGTT No data
Right 910760201 1:90725369-90725391 CCTGGTGCCAGCGGTCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910760201 Original CRISPR CCTGGTGCCAGCGGTCGGCC CGG Intergenic