ID: 910760819

View in Genome Browser
Species Human (GRCh38)
Location 1:90729617-90729639
Sequence GCAGGGCCGCGGGTCACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910760809_910760819 11 Left 910760809 1:90729583-90729605 CCAGCCAGGCGGGGGACTGCGGG No data
Right 910760819 1:90729617-90729639 GCAGGGCCGCGGGTCACCGCAGG No data
910760811_910760819 7 Left 910760811 1:90729587-90729609 CCAGGCGGGGGACTGCGGGCCGC No data
Right 910760819 1:90729617-90729639 GCAGGGCCGCGGGTCACCGCAGG No data
910760806_910760819 13 Left 910760806 1:90729581-90729603 CCCCAGCCAGGCGGGGGACTGCG No data
Right 910760819 1:90729617-90729639 GCAGGGCCGCGGGTCACCGCAGG No data
910760807_910760819 12 Left 910760807 1:90729582-90729604 CCCAGCCAGGCGGGGGACTGCGG No data
Right 910760819 1:90729617-90729639 GCAGGGCCGCGGGTCACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910760819 Original CRISPR GCAGGGCCGCGGGTCACCGC AGG Intergenic
No off target data available for this crispr