ID: 910761251

View in Genome Browser
Species Human (GRCh38)
Location 1:90733857-90733879
Sequence TTAAATCCACACTTAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910761251_910761252 -1 Left 910761251 1:90733857-90733879 CCTGTCTCTAAGTGTGGATTTAA No data
Right 910761252 1:90733879-90733901 AGTTTACGTTTTCCATTTGAAGG No data
910761251_910761253 0 Left 910761251 1:90733857-90733879 CCTGTCTCTAAGTGTGGATTTAA No data
Right 910761253 1:90733880-90733902 GTTTACGTTTTCCATTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910761251 Original CRISPR TTAAATCCACACTTAGAGAC AGG (reversed) Intergenic
No off target data available for this crispr