ID: 910761253

View in Genome Browser
Species Human (GRCh38)
Location 1:90733880-90733902
Sequence GTTTACGTTTTCCATTTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910761246_910761253 27 Left 910761246 1:90733830-90733852 CCCCTTTTTCATTGGCAAGAAAT No data
Right 910761253 1:90733880-90733902 GTTTACGTTTTCCATTTGAAGGG No data
910761248_910761253 25 Left 910761248 1:90733832-90733854 CCTTTTTCATTGGCAAGAAATGG No data
Right 910761253 1:90733880-90733902 GTTTACGTTTTCCATTTGAAGGG No data
910761251_910761253 0 Left 910761251 1:90733857-90733879 CCTGTCTCTAAGTGTGGATTTAA No data
Right 910761253 1:90733880-90733902 GTTTACGTTTTCCATTTGAAGGG No data
910761247_910761253 26 Left 910761247 1:90733831-90733853 CCCTTTTTCATTGGCAAGAAATG No data
Right 910761253 1:90733880-90733902 GTTTACGTTTTCCATTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910761253 Original CRISPR GTTTACGTTTTCCATTTGAA GGG Intergenic
No off target data available for this crispr