ID: 910762246

View in Genome Browser
Species Human (GRCh38)
Location 1:90745208-90745230
Sequence ACACAAAAGGGAGAGGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910762246_910762251 5 Left 910762246 1:90745208-90745230 CCTCCAACCTCTCCCTTTTGTGT No data
Right 910762251 1:90745236-90745258 TATGTCCCTTCTATTGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910762246 Original CRISPR ACACAAAAGGGAGAGGTTGG AGG (reversed) Intergenic
No off target data available for this crispr