ID: 910762425

View in Genome Browser
Species Human (GRCh38)
Location 1:90747159-90747181
Sequence TACTGCTGTTACCAATTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910762421_910762425 21 Left 910762421 1:90747115-90747137 CCTAGCTTCCTCTTGTCATCATA No data
Right 910762425 1:90747159-90747181 TACTGCTGTTACCAATTAAGTGG No data
910762422_910762425 13 Left 910762422 1:90747123-90747145 CCTCTTGTCATCATACCATTCTT No data
Right 910762425 1:90747159-90747181 TACTGCTGTTACCAATTAAGTGG No data
910762423_910762425 -2 Left 910762423 1:90747138-90747160 CCATTCTTTTCTTCCTTGTAATA No data
Right 910762425 1:90747159-90747181 TACTGCTGTTACCAATTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910762425 Original CRISPR TACTGCTGTTACCAATTAAG TGG Intergenic
No off target data available for this crispr