ID: 910763531

View in Genome Browser
Species Human (GRCh38)
Location 1:90758488-90758510
Sequence AACCCTGACCTACAACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910763531_910763536 23 Left 910763531 1:90758488-90758510 CCTGTCTGTTGTAGGTCAGGGTT No data
Right 910763536 1:90758534-90758556 TTGTGCATAAGAGATTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910763531 Original CRISPR AACCCTGACCTACAACAGAC AGG (reversed) Intergenic
No off target data available for this crispr