ID: 910763601

View in Genome Browser
Species Human (GRCh38)
Location 1:90759002-90759024
Sequence CTCTAGTTCTTGATGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910763601_910763610 11 Left 910763601 1:90759002-90759024 CCATCAGCCATCAAGAACTAGAG No data
Right 910763610 1:90759036-90759058 TCAGTCTAAGGGGAACTGGGTGG No data
910763601_910763606 0 Left 910763601 1:90759002-90759024 CCATCAGCCATCAAGAACTAGAG No data
Right 910763606 1:90759025-90759047 GGATGAGTGTGTCAGTCTAAGGG No data
910763601_910763607 1 Left 910763601 1:90759002-90759024 CCATCAGCCATCAAGAACTAGAG No data
Right 910763607 1:90759026-90759048 GATGAGTGTGTCAGTCTAAGGGG No data
910763601_910763608 7 Left 910763601 1:90759002-90759024 CCATCAGCCATCAAGAACTAGAG No data
Right 910763608 1:90759032-90759054 TGTGTCAGTCTAAGGGGAACTGG No data
910763601_910763605 -1 Left 910763601 1:90759002-90759024 CCATCAGCCATCAAGAACTAGAG No data
Right 910763605 1:90759024-90759046 GGGATGAGTGTGTCAGTCTAAGG No data
910763601_910763609 8 Left 910763601 1:90759002-90759024 CCATCAGCCATCAAGAACTAGAG No data
Right 910763609 1:90759033-90759055 GTGTCAGTCTAAGGGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910763601 Original CRISPR CTCTAGTTCTTGATGGCTGA TGG (reversed) Intergenic
No off target data available for this crispr