ID: 910765524

View in Genome Browser
Species Human (GRCh38)
Location 1:90778699-90778721
Sequence AACCCTTGACTAATAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910765518_910765524 25 Left 910765518 1:90778651-90778673 CCTAGAATGCAAATCTAGACATT No data
Right 910765524 1:90778699-90778721 AACCCTTGACTAATAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910765524 Original CRISPR AACCCTTGACTAATAAAGAT AGG Intergenic
No off target data available for this crispr