ID: 910766618

View in Genome Browser
Species Human (GRCh38)
Location 1:90788868-90788890
Sequence TGCTCCCTTTGTTAGATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910766616_910766618 22 Left 910766616 1:90788823-90788845 CCATTTGCACTCTTAGAATATAT No data
Right 910766618 1:90788868-90788890 TGCTCCCTTTGTTAGATTTATGG No data
910766617_910766618 -7 Left 910766617 1:90788852-90788874 CCAAATTGAAATTGTTTGCTCCC No data
Right 910766618 1:90788868-90788890 TGCTCCCTTTGTTAGATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910766618 Original CRISPR TGCTCCCTTTGTTAGATTTA TGG Intergenic
No off target data available for this crispr