ID: 910767195

View in Genome Browser
Species Human (GRCh38)
Location 1:90793486-90793508
Sequence TGAGGTCTGCTTAGGAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910767191_910767195 -9 Left 910767191 1:90793472-90793494 CCCTGATCAACTGGTGAGGTCTG No data
Right 910767195 1:90793486-90793508 TGAGGTCTGCTTAGGAGAGGTGG No data
910767188_910767195 13 Left 910767188 1:90793450-90793472 CCAGACTCATCACAAAATGGTGC No data
Right 910767195 1:90793486-90793508 TGAGGTCTGCTTAGGAGAGGTGG No data
910767192_910767195 -10 Left 910767192 1:90793473-90793495 CCTGATCAACTGGTGAGGTCTGC No data
Right 910767195 1:90793486-90793508 TGAGGTCTGCTTAGGAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910767195 Original CRISPR TGAGGTCTGCTTAGGAGAGG TGG Intergenic
No off target data available for this crispr