ID: 910769752

View in Genome Browser
Species Human (GRCh38)
Location 1:90818885-90818907
Sequence GGAGTAGGGTATCCCAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910769751_910769752 -10 Left 910769751 1:90818872-90818894 CCATCACATCTAGGGAGTAGGGT No data
Right 910769752 1:90818885-90818907 GGAGTAGGGTATCCCAAGTCAGG No data
910769745_910769752 16 Left 910769745 1:90818846-90818868 CCAGCCTAGTTGACACATAAAAG No data
Right 910769752 1:90818885-90818907 GGAGTAGGGTATCCCAAGTCAGG No data
910769746_910769752 12 Left 910769746 1:90818850-90818872 CCTAGTTGACACATAAAAGTAAC 0: 6
1: 172
2: 465
3: 713
4: 831
Right 910769752 1:90818885-90818907 GGAGTAGGGTATCCCAAGTCAGG No data
910769744_910769752 17 Left 910769744 1:90818845-90818867 CCCAGCCTAGTTGACACATAAAA No data
Right 910769752 1:90818885-90818907 GGAGTAGGGTATCCCAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910769752 Original CRISPR GGAGTAGGGTATCCCAAGTC AGG Intergenic
No off target data available for this crispr