ID: 910776983

View in Genome Browser
Species Human (GRCh38)
Location 1:90886641-90886663
Sequence TCCCCCAAAAAAAAAATCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910776978_910776983 27 Left 910776978 1:90886591-90886613 CCGAGATCACGCCACTACACTAC 0: 7
1: 692
2: 20131
3: 85611
4: 135467
Right 910776983 1:90886641-90886663 TCCCCCAAAAAAAAAATCTACGG No data
910776982_910776983 2 Left 910776982 1:90886616-90886638 CCTGGGTGACAAGAGTGAAACTC 0: 1540
1: 4633
2: 18833
3: 28794
4: 30227
Right 910776983 1:90886641-90886663 TCCCCCAAAAAAAAAATCTACGG No data
910776981_910776983 16 Left 910776981 1:90886602-90886624 CCACTACACTACAGCCTGGGTGA 0: 53
1: 4524
2: 96901
3: 185026
4: 209305
Right 910776983 1:90886641-90886663 TCCCCCAAAAAAAAAATCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910776983 Original CRISPR TCCCCCAAAAAAAAAATCTA CGG Intergenic
No off target data available for this crispr