ID: 910777310

View in Genome Browser
Species Human (GRCh38)
Location 1:90889916-90889938
Sequence ACTTCTGCTGATACAGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910777310_910777311 -9 Left 910777310 1:90889916-90889938 CCTGGATCTGTATCAGCAGAAGT No data
Right 910777311 1:90889930-90889952 AGCAGAAGTACTTCAATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910777310 Original CRISPR ACTTCTGCTGATACAGATCC AGG (reversed) Intergenic
No off target data available for this crispr