ID: 910782844

View in Genome Browser
Species Human (GRCh38)
Location 1:90959692-90959714
Sequence TTACTTTACCAGGTGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910782840_910782844 14 Left 910782840 1:90959655-90959677 CCAGAACAGGCAAATATATAGAG 0: 3
1: 58
2: 395
3: 1294
4: 2452
Right 910782844 1:90959692-90959714 TTACTTTACCAGGTGATGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910782844 Original CRISPR TTACTTTACCAGGTGATGGA AGG Intronic
904623188 1:31787881-31787903 CTAACTTACCAGGTGATGGGAGG - Intergenic
905344912 1:37304736-37304758 CTACTTTACAAGGTCATGGTGGG + Intergenic
906816438 1:48885051-48885073 TTACTTGACTGGGTGCTGGAAGG + Intronic
907990428 1:59577132-59577154 TGACTGTACCAGGTGCTGGGAGG - Intronic
910782844 1:90959692-90959714 TTACTTTACCAGGTGATGGAAGG + Intronic
914848151 1:151294128-151294150 TTCCCTTTCCAGGTGATGGGCGG - Exonic
916000543 1:160611080-160611102 TTTCCTTACAAGGGGATGGAAGG - Intronic
920275944 1:204804358-204804380 TTGAGTTCCCAGGTGATGGATGG - Intergenic
1063147809 10:3312082-3312104 TGACTTCACCAAGTGAGGGAGGG - Intergenic
1064461840 10:15542112-15542134 TTACTTTACGAGGGGATATAAGG + Intronic
1064902288 10:20308396-20308418 AGACTTTACCATTTGATGGAAGG + Intergenic
1065738853 10:28778493-28778515 TTCCTGTACCATGGGATGGAGGG + Intergenic
1071502071 10:86211356-86211378 TTACTTTCCCAGCTGATGGATGG - Intronic
1072487009 10:95865211-95865233 ATACTTTCCCAGCTTATGGAAGG - Intronic
1073573624 10:104601843-104601865 TAACTTTTCCAGGAGAAGGAAGG - Intergenic
1075468454 10:122670122-122670144 GGATTTTAGCAGGTGATGGATGG + Intergenic
1077992984 11:7428680-7428702 TTGCTTTCCCAGGTAATGGAAGG + Intronic
1080419808 11:32099740-32099762 TTAGTTATCCAGGTGGTGGAAGG + Intronic
1088736099 11:112728977-112728999 TTTCTTAAACAGGTGTTGGATGG + Intergenic
1088750986 11:112841951-112841973 TTAATTAACCAGGTGCTGGGTGG - Intergenic
1090688235 11:129149062-129149084 TTAGTTTGTCAGGTGATGGATGG - Intronic
1098796335 12:74893062-74893084 TTATTTCACCAGGTGAAGCAGGG + Intergenic
1100494824 12:95114757-95114779 TTAATTTAACAGGTAATGGGAGG - Intronic
1101401123 12:104387997-104388019 TTACCTTACCATTTGATGAAGGG + Intergenic
1109042103 13:57352185-57352207 TTACAGTAACAGGTGGTGGAAGG - Intergenic
1111891171 13:94084062-94084084 TTAGCTTCCCAGGAGATGGAAGG - Intronic
1112355272 13:98669451-98669473 TAACTTTACAAGTTGATTGAGGG + Intergenic
1114226153 14:20740759-20740781 CTCCTTCACCAGGTGAAGGAGGG - Intronic
1114227646 14:20753594-20753616 CTCCTTCACCAGGTGAAGGAGGG - Intergenic
1115332941 14:32217617-32217639 TTCCTCTACCACGTGAGGGAGGG - Intergenic
1115502811 14:34064399-34064421 TTACTTTCACAGGTTCTGGATGG - Intronic
1117116512 14:52518712-52518734 CTACTATACCAGGTAAAGGAGGG + Intronic
1121165872 14:91798371-91798393 TTACTCTATCAGGAGATGAAAGG - Exonic
1121420686 14:93811282-93811304 TGACCTTAACAGGTGCTGGATGG - Intergenic
1123214158 14:106791097-106791119 TTATTTTACAAGGTGATTTATGG - Intergenic
1125295084 15:38194021-38194043 TTATTTTACAAGGCAATGGAAGG + Intergenic
1132040807 15:98523315-98523337 TTATTTTAATTGGTGATGGAGGG - Intergenic
1135714416 16:24749300-24749322 TTACTTTACAGTGTGATGGAGGG + Intronic
1137775769 16:51053288-51053310 TTACTTGACCAGGGGAGGAAGGG - Intergenic
1138069967 16:53983035-53983057 TTACTTTACCATGTGAGGCTCGG - Intronic
1144106709 17:11992669-11992691 TTCCGTTACCAGGTGATGTCTGG - Exonic
1148937429 17:51174778-51174800 TTACTTTCCCAAGTGATGTGAGG + Intergenic
1150174309 17:63034024-63034046 TTGGTTTCCCAGGTGAAGGACGG - Intronic
1151335206 17:73435611-73435633 TCCTTGTACCAGGTGATGGAGGG + Exonic
1153442509 18:5136054-5136076 CTACTTTACAAAATGATGGAGGG + Intergenic
1153731019 18:8011843-8011865 TTCCTTTTCAAGGTGAAGGAGGG - Intronic
1153955677 18:10093661-10093683 CTACATCACCAGGTGATAGAAGG - Intergenic
1155795296 18:30027888-30027910 TTACTTCACCAGATTATAGAAGG - Intergenic
1156897911 18:42267589-42267611 GAATTTTACCAGGTGATGGTTGG - Intergenic
1159959727 18:74546165-74546187 TTACGTTTCTAGATGATGGAAGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
925360500 2:3277455-3277477 AAACCTTACCAGGTGATGGGTGG + Intronic
932086283 2:68765177-68765199 TCACTTTATCAGCTGATGAATGG - Intronic
934524860 2:95045494-95045516 TTCCCTGACCAGGTGATGGTGGG - Intronic
934787850 2:97027967-97027989 TTACTTTCCCAGGTGACTCAGGG - Intergenic
937477796 2:122230334-122230356 CTCCTTTCCCACGTGATGGAAGG - Intergenic
941327023 2:164128524-164128546 TTACTCTCCCAGGGGAAGGAAGG + Intergenic
941512552 2:166431308-166431330 TGGCTTTAGTAGGTGATGGAAGG + Intronic
947659912 2:231858936-231858958 TTACTTTACCACCAAATGGATGG + Intergenic
948916722 2:241038041-241038063 TTTCTTTACCAGGTGGGTGAAGG - Intronic
1170405211 20:16028569-16028591 TGTCTTTACCAAGTGATGAAAGG - Intronic
1180651451 22:17380645-17380667 TTACTTTTGGAGGTGATGGGTGG - Intronic
955042456 3:55331355-55331377 TTACCTTACCAGTTGTTGTAAGG - Intergenic
960482176 3:118205019-118205041 TTACTTAACAAGGAGATTGAGGG + Intergenic
963261979 3:143202055-143202077 TTACATGACAAGGTCATGGAAGG - Intergenic
964392727 3:156214157-156214179 TTACTTTACCAGTTTATTAAAGG - Intronic
964589681 3:158346618-158346640 TCACTCTACCAAGTGATGGTTGG + Intronic
964864071 3:161234715-161234737 TTGTTTTATCAGGTGATGAATGG + Exonic
966217948 3:177521620-177521642 GTAGCTTACCTGGTGATGGAGGG + Intergenic
966277072 3:178186454-178186476 TTCCTTTACAAGGACATGGATGG + Intergenic
971007242 4:22388937-22388959 TTTCTTTTCCAGTTGCTGGATGG - Exonic
974407211 4:61489136-61489158 TTATTTTACCAGGTGGTTTAAGG - Intronic
976095457 4:81503742-81503764 TGACTTTACCAGTTGGCGGAGGG + Intronic
980863563 4:138528049-138528071 TTAATATACTAGGTGATGCAAGG + Intergenic
981605268 4:146533648-146533670 AAACTTTAGAAGGTGATGGAAGG + Intergenic
981749383 4:148079094-148079116 TTACTTAACCAGGTTTGGGATGG - Exonic
982417613 4:155155572-155155594 TTGCTTTTCTAGGTGTTGGAAGG - Intergenic
983398968 4:167238550-167238572 TTACCTTCCCAGCTGGTGGAAGG + Intergenic
984159440 4:176233524-176233546 TATCATTACCAGGTGATGGAGGG - Intronic
984503751 4:180591082-180591104 TTATTTTCTAAGGTGATGGACGG - Intergenic
984733753 4:183091659-183091681 GTACTTTTCAATGTGATGGAGGG + Intergenic
986952553 5:13108099-13108121 TTACTTTAACAGGTGAATAAAGG + Intergenic
990046433 5:51437973-51437995 TTACTTTAGCAGGTGTGTGATGG + Intergenic
991979260 5:72214654-72214676 TTACTAAAGCAGGTGAGGGAAGG - Intergenic
993333264 5:86625807-86625829 TTACTATACCAGGTTAAGGAAGG - Intergenic
993366027 5:87035246-87035268 TTGGTTTCTCAGGTGATGGATGG + Intergenic
994544256 5:101142864-101142886 TTACTTTATCTGGTGATGTGTGG + Intergenic
995563379 5:113407556-113407578 TTATTTAACCAGGTGATGCTTGG - Intronic
996387304 5:122922978-122923000 TTACTTTCCCAGGATATGCATGG - Intronic
999556531 5:152748902-152748924 TAACTTTACAAGGACATGGATGG + Intergenic
1001293368 5:170481993-170482015 ATGCTTTAGCAGCTGATGGAGGG - Intronic
1002469255 5:179425411-179425433 TTCCTTTACAAGGTGAAGGAAGG + Intergenic
1003822086 6:9909942-9909964 TTATTTTACCAGCATATGGAAGG - Intronic
1006898843 6:37487044-37487066 TTAATTTCCCAGGAGAAGGAGGG - Intronic
1007932397 6:45703902-45703924 TAATTTTTCCAGGTGATGGTCGG + Intergenic
1008028323 6:46664400-46664422 TTAATTTTACTGGTGATGGAAGG - Intronic
1013492934 6:110667477-110667499 TTACTTTACCAGATTCTTGATGG - Exonic
1013500120 6:110740902-110740924 TTAGTTTTCCTGGTGGTGGAAGG - Intronic
1017151083 6:151281328-151281350 TTACTTTGACAGGTGAAGGATGG + Intronic
1020588398 7:10102931-10102953 TTATTTTAACAGGTGTGGGATGG - Intergenic
1021313607 7:19118953-19118975 TTACTTTGCCATGTAAGGGATGG - Intergenic
1025077413 7:55954851-55954873 TTACATTACCAGGTCACAGATGG + Intronic
1026357155 7:69568368-69568390 TTACTTGAGCAGGACATGGATGG - Intergenic
1026606214 7:71818261-71818283 TGACTTTGCCAGGTGAGTGAGGG + Intronic
1027894321 7:84021641-84021663 TTAGTTTACAAGATGATGGAGGG - Intronic
1031472399 7:122182547-122182569 TTAAGTTAGCAGGTGATGAATGG - Intergenic
1034082285 7:148290325-148290347 TCTCTTTACCATGTGATAGAGGG - Intronic
1035169161 7:157008420-157008442 TGACTCTCCCAGGTGAGGGATGG + Intronic
1037271204 8:17132354-17132376 TTACTCTACCAGGTTCTGGCTGG - Intergenic
1039198579 8:35060711-35060733 CTACTTTCTCAAGTGATGGACGG + Intergenic
1039685127 8:39793378-39793400 TAACATTACCAAGGGATGGATGG + Intronic
1045026639 8:98093209-98093231 TTACTTTTCCAGGTGAGACAGGG + Exonic
1047150236 8:122252674-122252696 TCCCATTGCCAGGTGATGGAGGG + Intergenic
1050802692 9:9635876-9635898 TAATTTTTCCAGGTGAAGGATGG - Intronic
1053108809 9:35438815-35438837 CTACTTCACCAGGTCATCGATGG - Intergenic
1055381435 9:75711409-75711431 TTTCAATATCAGGTGATGGAAGG - Intergenic
1059251253 9:112889853-112889875 TTGCTTTTCCAGGAGATGGAGGG + Exonic
1061376170 9:130226158-130226180 TTTCTTCACCTGGGGATGGAGGG - Intronic
1061832429 9:133304342-133304364 TTACTTTGGCAGCTGATGGGCGG + Intergenic
1188139717 X:26534801-26534823 ATACTTTGACAGGTGGTGGAAGG + Intergenic
1191946622 X:66541154-66541176 TTTCTTTATCATGTGATGTAAGG + Intergenic
1194766144 X:97846721-97846743 CTACTTTACCAGAGGATTGAGGG - Intergenic
1197145876 X:123171653-123171675 TTACTTTTTCAAGGGATGGAGGG - Intergenic
1198329293 X:135606877-135606899 TGACATTACCAGGTGCTGGCTGG - Intergenic
1199087580 X:143646222-143646244 TGACCTTGCCATGTGATGGAAGG - Intergenic
1202097960 Y:21273241-21273263 TTTCTTTTCCAGAGGATGGAGGG + Intergenic