ID: 910787419

View in Genome Browser
Species Human (GRCh38)
Location 1:91015474-91015496
Sequence GACTATTAGTAGAGAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910787419_910787423 9 Left 910787419 1:91015474-91015496 CCTTCTTCTCTCTACTAATAGTC 0: 1
1: 0
2: 3
3: 16
4: 264
Right 910787423 1:91015506-91015528 CCTCACAGTCAAAAATTGAAAGG 0: 1
1: 0
2: 1
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910787419 Original CRISPR GACTATTAGTAGAGAGAAGA AGG (reversed) Intronic
901269636 1:7941983-7942005 GAGTATAAGGAGAAAGAAGAGGG + Intronic
901422423 1:9160203-9160225 GTCTATGAGCAGGGAGAAGAGGG - Intergenic
901649378 1:10734898-10734920 AACAATTACTGGAGAGAAGAGGG + Intronic
905329665 1:37185153-37185175 AACTATTAATAGAGATAAGAAGG + Intergenic
905613515 1:39376569-39376591 GACTAGTAGGTGGGAGAAGACGG - Intronic
906290763 1:44617919-44617941 GACAATTGGAGGAGAGAAGAGGG - Intronic
906921415 1:50068452-50068474 GTCTAGTAGTAGAGTGTAGAAGG + Intronic
908629759 1:66090019-66090041 AACTCTTAGGAAAGAGAAGAAGG + Intronic
909205235 1:72748131-72748153 ATCTATTATAAGAGAGAAGAAGG + Intergenic
910069824 1:83198613-83198635 GACAATGACTAGAGATAAGAGGG - Intergenic
910787419 1:91015474-91015496 GACTATTAGTAGAGAGAAGAAGG - Intronic
911291455 1:96060999-96061021 GAAAATTAGTGCAGAGAAGATGG + Intergenic
914955935 1:152162494-152162516 GACTACTAGAAGGGGGAAGAAGG - Intergenic
916633578 1:166642972-166642994 GCCAATTACTAGATAGAAGAGGG + Intergenic
917776363 1:178339657-178339679 GACTATTTGTAGAAATAAAATGG - Intronic
918420123 1:184355682-184355704 GACTACTAGTTAAAAGAAGATGG - Intergenic
918859747 1:189807966-189807988 GACTACTAGATGAGAGAAGGAGG - Intergenic
919171577 1:193960795-193960817 AACTAATGGTAGAGAGAAAAGGG + Intergenic
1063347270 10:5323816-5323838 CACTATTAGCAAAGAAAAGATGG + Intergenic
1063967751 10:11360026-11360048 GACTTGTAGGAAAGAGAAGAAGG + Intergenic
1065989946 10:30999298-30999320 GGGACTTAGTAGAGAGAAGAGGG - Intronic
1066756135 10:38714732-38714754 GAGTATTAGAAGAGAGAATGGGG - Intergenic
1070250037 10:74765608-74765630 GTCTGTGAGTAGAGAGAATATGG + Intergenic
1073248447 10:102107523-102107545 GACTTTTAATAGGGGGAAGAGGG + Intergenic
1073381875 10:103084148-103084170 GACTAAAAGTGGAGAGAAAAGGG - Exonic
1074170675 10:110932435-110932457 GGCTATTAGAAGAGAGAATTTGG + Intronic
1075417064 10:122271979-122272001 GAATCTGAGAAGAGAGAAGAGGG - Intronic
1076708294 10:132314761-132314783 GAATATTATTAGAGATAAAAAGG + Intronic
1078027624 11:7712245-7712267 GATTATAAGTAGTGAAAAGAAGG + Intergenic
1078958621 11:16234967-16234989 GACTGATAGTACAGAAAAGAGGG + Intronic
1080150837 11:29050618-29050640 GACTTTGAGATGAGAGAAGAAGG - Intergenic
1080175999 11:29363903-29363925 AAATAATAGGAGAGAGAAGAGGG + Intergenic
1080465282 11:32490573-32490595 GACTAATAGTAGAGATTAAAAGG - Intergenic
1082282512 11:50285456-50285478 GAATATTACTTGAGAGTAGAAGG + Intergenic
1082759197 11:57109996-57110018 CACTATTGGGAGATAGAAGAGGG - Intergenic
1084117873 11:67052523-67052545 GAAGATTACAAGAGAGAAGAAGG - Intergenic
1087609624 11:100418421-100418443 TTCTATTAGTAAAAAGAAGATGG + Intergenic
1088856459 11:113759307-113759329 GAATATTAGTTAAGAGAAGAGGG - Intronic
1089236389 11:117029955-117029977 GAATATACATAGAGAGAAGAGGG + Intronic
1090176112 11:124651236-124651258 GTCTATTAGTTGATAGAATAAGG + Intronic
1090556582 11:127883087-127883109 GACCAGTGGGAGAGAGAAGACGG - Intergenic
1090678556 11:129028732-129028754 GACTAGTGGTGGAGAGGAGATGG + Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1090979962 11:131710994-131711016 GAGAATAAGGAGAGAGAAGAAGG - Intronic
1091268544 11:134289549-134289571 AACTATTAGAAGACAGAACATGG + Intronic
1092687376 12:11065394-11065416 GAAGATTAGAAGAGAGAAAATGG - Intronic
1092738447 12:11606246-11606268 AGCTCTTAGAAGAGAGAAGATGG + Intergenic
1094356127 12:29579627-29579649 GAAGATTAGGAGAGGGAAGAGGG + Intronic
1096828890 12:54299663-54299685 GACTATTCGGAGAGGGATGATGG + Intronic
1097922199 12:65088339-65088361 GACTATTTGTAGATAGATGGGGG - Intronic
1098400367 12:70068827-70068849 GAATATTTATAGACAGAAGAAGG + Intergenic
1099041094 12:77655113-77655135 GACTTTGAGTTGAGAGAAGAAGG + Intergenic
1099437052 12:82657812-82657834 TACTATTAGAACAGAGATGAAGG - Intergenic
1099778972 12:87170474-87170496 GACTATCAGTGAAGAGATGATGG + Intergenic
1099831728 12:87852243-87852265 GACTAGTGGGATAGAGAAGAGGG + Intergenic
1099840223 12:87955416-87955438 GACTACTAGAGGAGTGAAGAGGG - Intergenic
1100017252 12:90025491-90025513 GACTCTTATAAGAGAGAAGCAGG - Intergenic
1101277222 12:103216152-103216174 GGCTCATATTAGAGAGAAGAAGG - Intergenic
1103080868 12:118023094-118023116 TACCATTAGTAGAAAGGAGAGGG - Intronic
1105236681 13:18562791-18562813 GAATATTAGCTGAGAGAGGAAGG + Intergenic
1105424134 13:20279987-20280009 GAGTATTGGTAAAGAGCAGATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107530547 13:41278587-41278609 GGATATTAGTGGAGAGAAGAAGG - Intergenic
1107631482 13:42347636-42347658 GACTATTAGATGAGGGGAGAGGG - Intergenic
1107697562 13:43015126-43015148 AAATATTATTAAAGAGAAGAAGG + Intergenic
1109828802 13:67757993-67758015 AATTTTCAGTAGAGAGAAGATGG - Intergenic
1109906642 13:68850977-68850999 GACTAAAATGAGAGAGAAGAAGG - Intergenic
1110650104 13:77934168-77934190 GAGTATGACTAGAGAGAATAAGG + Intergenic
1110789417 13:79570573-79570595 GAATGTTACTAGAGAGAAGCAGG + Intergenic
1110860763 13:80342253-80342275 GACTTTTAGTTAAGGGAAGAAGG - Intergenic
1110974405 13:81811044-81811066 AACTATTAGAAGAGCAAAGAAGG + Intergenic
1111364999 13:87231856-87231878 AACTATAAGAAGAGACAAGAAGG - Intergenic
1111820058 13:93202697-93202719 CACAATTAGTAGAGAGGAAAAGG + Intergenic
1116292051 14:43056597-43056619 GACTATTAGGGTAGAGAGGAAGG - Intergenic
1116377410 14:44221191-44221213 AAATAATAGTAGAAAGAAGAAGG + Intergenic
1116851739 14:49915728-49915750 GTCTATTAGTACACAAAAGAAGG - Intergenic
1118628768 14:67683803-67683825 AAATATTAGTAGGGAGAGGAGGG - Intronic
1120278948 14:82414503-82414525 GACTATTAGAGAAGAGAGGAAGG - Intergenic
1120996549 14:90422332-90422354 GACGCTTAGTAGAGAAGAGACGG - Intergenic
1125003374 15:34794420-34794442 GGCCATTAGTGGAGAGAAGCAGG + Intronic
1125588740 15:40841166-40841188 GACTACCAGAAGAGAGAAGGAGG - Intergenic
1127887676 15:63216959-63216981 GACTTTTGCTAGAGAGAAGTTGG + Intronic
1128230128 15:66028992-66029014 GACTACAAGGAGAGAGAGGAGGG + Intronic
1129109400 15:73328905-73328927 GACTTGGAGTAGAGAGAACAGGG + Intronic
1130766651 15:86877850-86877872 GAATGTGAGAAGAGAGAAGAAGG - Intronic
1131773124 15:95762766-95762788 TAGTATTAATAGAGAGGAGATGG - Intergenic
1133869121 16:9671502-9671524 TACTATGACTAGACAGAAGATGG + Intronic
1135923988 16:26676200-26676222 GACTAAGAGTAGAGGAAAGATGG + Intergenic
1136004905 16:27322733-27322755 AAGTATTAGAAGAGAGAAGGTGG - Intronic
1138713988 16:59000790-59000812 GACAATGAATAGAGAGAAGAAGG - Intergenic
1140451718 16:75076133-75076155 TACTTTTAGTATGGAGAAGATGG - Intronic
1140751110 16:78024738-78024760 GAGGATTGGGAGAGAGAAGATGG - Intronic
1144353094 17:14417610-14417632 CAATATTTGTAGAGAGAAAAAGG + Intergenic
1144803189 17:17945596-17945618 GGCTGTAAATAGAGAGAAGATGG - Intronic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1149209029 17:54282401-54282423 GACTATTGGCAGAGAGGAGATGG - Intergenic
1149427599 17:56570123-56570145 GACTATGAGAAGAGGGAGGAAGG + Intergenic
1153397756 18:4643919-4643941 GAATCAGAGTAGAGAGAAGAGGG + Intergenic
1155442844 18:25880214-25880236 GACTACTAGTGGAGGGAAGGTGG + Intergenic
1156356353 18:36344915-36344937 AAATATTACTAGAGAGAAGGAGG + Intronic
1156735411 18:40252182-40252204 CTCTATCAATAGAGAGAAGAAGG - Intergenic
1158066538 18:53416892-53416914 GACAATTAGTAGAAAGCTGAGGG + Intronic
1159308282 18:66674314-66674336 AACTATTAGCAGAGAGAAAGGGG - Intergenic
1159662872 18:71120805-71120827 GACTACTAGTAGGGGAAAGAAGG - Intergenic
1160253740 18:77228497-77228519 GGCTAAAAGTAGTGAGAAGAGGG + Intergenic
1163539548 19:17899365-17899387 GTATTTTAGTAGAGAGTAGAGGG + Intergenic
925030577 2:647658-647680 GACCATTTCTAGAGATAAGAAGG + Intergenic
925395517 2:3530585-3530607 TATTATTAGTAGGGGGAAGAAGG + Intergenic
925828469 2:7873690-7873712 GAGTATGACTAGACAGAAGATGG + Intergenic
926527700 2:14002816-14002838 GACTCATAGTATAGAGTAGAAGG + Intergenic
927106049 2:19827026-19827048 GAGTGTTAGCAGAGATAAGAAGG + Intergenic
927284002 2:21337072-21337094 GATGATGAGTTGAGAGAAGAAGG + Intergenic
928411398 2:31057120-31057142 GACTACTACTAGACAGGAGAAGG + Intronic
929660553 2:43780081-43780103 GACTGTTAGTGGGGGGAAGAGGG + Intronic
931471966 2:62547445-62547467 TAATATTAGTAGTGGGAAGAGGG - Intergenic
933121896 2:78548381-78548403 GAGAGTTAGTAGAGACAAGAGGG + Intergenic
935157805 2:100498752-100498774 GACTACTAGAAGAGGGAAGGAGG - Intergenic
935802276 2:106710268-106710290 GTCTATGATTAGAAAGAAGAGGG - Intergenic
936662422 2:114557152-114557174 GACTACTACTAGAGAGAAAAAGG - Intronic
938513107 2:131971759-131971781 GAATATTAGCTGAGAGAGGAAGG - Intergenic
938728043 2:134123912-134123934 CACTCTTAGTAGCCAGAAGATGG + Intronic
939446395 2:142315158-142315180 TACTGTTAGTAGAGAGGAAACGG - Intergenic
939637424 2:144599348-144599370 GAGTAATAGTACAAAGAAGAAGG - Intergenic
939741093 2:145907361-145907383 GACAATTACTAGAGATAAAAAGG + Intergenic
940342954 2:152600560-152600582 GGCTAATAGTGGAGAGGAGATGG - Intronic
941641664 2:167995601-167995623 GAGTATCAAGAGAGAGAAGATGG + Intronic
941836846 2:170031675-170031697 GACTACTAGAAGAGGGAAGGAGG - Intronic
941975186 2:171396396-171396418 GACTGTTACCAGAGATAAGAAGG - Intronic
942258400 2:174130579-174130601 GGCTATTAGTAAAGAGAAGAAGG + Intronic
942845488 2:180419562-180419584 GACTATTAGAAGAAAGAAGGTGG + Intergenic
943168213 2:184360444-184360466 GATTATGAGAAGAGAGAAGTTGG + Intergenic
943751959 2:191518816-191518838 AACTCTTTGTAGAGAAAAGAGGG - Intergenic
944146192 2:196510010-196510032 GGCTATTAATGGAGAGAAGGAGG - Intronic
944742701 2:202627697-202627719 GCCTATTTTTAGAGAGACGAGGG + Intergenic
946442148 2:219705573-219705595 CATTTTTAGTGGAGAGAAGAAGG + Intergenic
946656203 2:221950710-221950732 GACTTTTAAGAGTGAGAAGAAGG + Intergenic
948741382 2:240048766-240048788 GACTAAGAGGAGAGAGAAGAGGG - Intergenic
1168740556 20:187411-187433 GACTAATAGAAGAGGGAAGGAGG + Intergenic
1169318534 20:4612336-4612358 GACTGCAAGTGGAGAGAAGAGGG + Intergenic
1169365229 20:4986696-4986718 GAATATAAATAGAGAGAAGTGGG + Intronic
1170034331 20:11973999-11974021 TACTATTAGTACAAGGAAGAAGG + Intergenic
1173032670 20:39376825-39376847 GATTATAAGGAAAGAGAAGAAGG + Intergenic
1173501769 20:43559081-43559103 GACCATGAAGAGAGAGAAGAGGG + Intronic
1173715718 20:45203079-45203101 GACTACTAGAGGAGAGAAGGAGG + Intergenic
1176697824 21:10002044-10002066 GACTATTACAAGAGGGAGGAAGG - Intergenic
1176780669 21:13191078-13191100 GAATATTAGCTGAGAGAGGAAGG + Intergenic
1177978347 21:27880193-27880215 GAATATTAGCTGAGAGAGGAAGG + Intergenic
1178677307 21:34642191-34642213 GATCATTAGTAGAGAGGAAAAGG + Intergenic
949964121 3:9340823-9340845 GACTATTAGAAGAGACAATGGGG + Intronic
951547432 3:23841901-23841923 TTCTATTAGGAGAGAGATGAAGG + Intronic
952862355 3:37823903-37823925 AACTATTAATAGACAGATGAAGG - Intergenic
953091709 3:39733636-39733658 TACTATTAATAGCTAGAAGAAGG - Intergenic
954202225 3:49030532-49030554 GCCTATCAGCAGAGAGCAGATGG - Exonic
954888498 3:53900217-53900239 GACTAATATAAGACAGAAGAAGG + Intergenic
955035639 3:55264567-55264589 GAGGATGAGGAGAGAGAAGAAGG + Intergenic
955442686 3:58974258-58974280 GACTACTAGTAGGGGGAAGGTGG - Intronic
956693108 3:71895832-71895854 AACTGAGAGTAGAGAGAAGATGG + Intergenic
956929289 3:74024492-74024514 GACTATGGTTAGAGTGAAGATGG - Intergenic
957668515 3:83268929-83268951 GACTACTAGAGGAGGGAAGAAGG - Intergenic
957737727 3:84224642-84224664 GACAATTAGAAGAGTGAGGATGG + Intergenic
959437308 3:106332259-106332281 GATAATTTGTAGAGAGATGATGG + Intergenic
962261349 3:133910366-133910388 GAATATTAGTAAAATGAAGAAGG - Intergenic
963458600 3:145577975-145577997 GACTTGTAGGAGAGAGATGAAGG - Intergenic
963544532 3:146639236-146639258 GACTTGTTGTAGAGAGAAGAGGG - Intergenic
963806935 3:149732350-149732372 GACTATTAGTGCAGGGAACAGGG + Intronic
964800532 3:160552178-160552200 GACTAACAGTAGTGAGAATATGG + Intronic
965136073 3:164770231-164770253 GACTATGAGAAGAAAGAAGATGG - Intergenic
966483373 3:180438388-180438410 GAATATTATTAGAGAGACAATGG + Intergenic
967546766 3:190739203-190739225 GAATAATAATACAGAGAAGAAGG + Intergenic
967684245 3:192400810-192400832 GACTATGAGTGGAGAGTCGAAGG - Intronic
970467521 4:16341600-16341622 GAATATTATTAGAGAAAAAAAGG - Intergenic
971565583 4:28136325-28136347 GGCTATTATTAGAGACAAGGAGG - Intergenic
972985724 4:44762201-44762223 GTTTAATAGCAGAGAGAAGATGG + Intergenic
974846190 4:67353317-67353339 TCCTATGAGTAGGGAGAAGATGG + Intergenic
976576581 4:86679388-86679410 GACCACTAGTAGAGAGCATAGGG - Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
978365689 4:107979040-107979062 GACTATTAGTAGAAAACAGCTGG + Intergenic
979064081 4:116104634-116104656 GACTATTAGTACATAGAAGAGGG - Intergenic
980254571 4:130362072-130362094 GAATATTAGTCTAGAGAAAATGG + Intergenic
980319439 4:131250221-131250243 GACTATTAGGAGAGAGAGAGGGG - Intergenic
980370371 4:131861917-131861939 GACTATTACAAGAGGGAGGAAGG - Intergenic
982412049 4:155089423-155089445 GAATATTAGTAGCGTGAAGTAGG - Intergenic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
982853771 4:160354452-160354474 TACTATTACTTGAGAGAAAAGGG + Intergenic
984208648 4:176818112-176818134 GACTATGAATGGAGAGAACAGGG - Intergenic
985400053 4:189585472-189585494 TACTATGAGTAGAGAGACAATGG + Intergenic
986611342 5:9570884-9570906 GATTATTATGAGAAAGAAGAGGG + Intergenic
987620332 5:20331874-20331896 TAATATTAGAAAAGAGAAGAAGG + Intronic
987687509 5:21224622-21224644 GAATATTTCTAAAGAGAAGATGG - Intergenic
989456572 5:41650874-41650896 GACTTGGAGTAGAAAGAAGATGG + Intergenic
989651338 5:43694318-43694340 GACTAGGAGTGGTGAGAAGAGGG + Intronic
990061898 5:51660719-51660741 TACTATAAGTAGAGAGTATAAGG - Intergenic
990776529 5:59311082-59311104 TACCATTAGCAGAGAGATGAAGG + Intronic
991083782 5:62629388-62629410 GACTAGTAGGAGAGAGAGGAGGG - Intergenic
991128071 5:63090151-63090173 GACTATTAGAAGAAAAAAGGAGG + Intergenic
991595652 5:68302732-68302754 GTCTAGTAGTAGAGGGGAGAGGG + Intergenic
992475450 5:77097444-77097466 GATTATTAGTAGACACAATATGG + Intergenic
993404888 5:87499472-87499494 GGCTCTCAGTAGAGAGGAGAGGG - Intergenic
994127968 5:96190879-96190901 GACTACTAGAGGAGAGAGGAAGG - Intergenic
994426433 5:99594100-99594122 GTCTGTTAGTAGATAGAATATGG + Intergenic
995850209 5:116536962-116536984 GGCTATTAGGAGAGGAAAGATGG + Intronic
996429502 5:123356585-123356607 GATTAAAAGGAGAGAGAAGAAGG - Intronic
996725261 5:126668738-126668760 GAGTATGACTAGACAGAAGATGG + Intergenic
997313477 5:132911287-132911309 GATTTTTAGTAGAAAGATGAGGG - Intronic
997602326 5:135149237-135149259 CTCTATTAAGAGAGAGAAGAAGG + Intronic
999323139 5:150626923-150626945 GACTAGGGGTGGAGAGAAGATGG - Intronic
999527487 5:152423351-152423373 GATTGTCATTAGAGAGAAGATGG + Intronic
1000716983 5:164656401-164656423 AACAATGAGTAAAGAGAAGAGGG + Intergenic
1002318283 5:178359810-178359832 GCCTATTTCTAGGGAGAAGATGG + Intronic
1004803547 6:19177627-19177649 GAATATGAGAAGAGAAAAGAGGG + Intergenic
1006014584 6:31069946-31069968 GACTATAAGTAGATAAAATAAGG - Intergenic
1007015103 6:38457742-38457764 GAGTATAAGTAGAGAAAATAGGG + Intronic
1007153821 6:39723154-39723176 GATTATTAGAGGAGAGAAAATGG + Intronic
1007885052 6:45218175-45218197 GAATATTAATAGAAAGCAGAAGG + Intronic
1010189929 6:73184877-73184899 GAGTATTTGGAGAGAGAAGGGGG + Intronic
1011059217 6:83244439-83244461 TACTATTAGTATATAGTAGAAGG - Intronic
1011118131 6:83918763-83918785 GACTGGTGGTAGAGAGAAAAGGG - Intronic
1012435523 6:99211251-99211273 GACTATTCTGAGAGAGCAGAGGG + Intergenic
1012567227 6:100673145-100673167 GACTATTAATAGAAATAAGTTGG + Intronic
1012754456 6:103207490-103207512 AACTATTAGGATAGTGAAGAAGG - Intergenic
1013967437 6:115971898-115971920 GACTAAGAGCAGAGAGAAGAGGG + Intronic
1014879241 6:126701970-126701992 GACTTTTAGTTGATAGTAGAGGG + Intergenic
1016369664 6:143359796-143359818 AACTAATAGTGGAGATAAGATGG + Intergenic
1018870147 6:167776521-167776543 GACAATTATTACACAGAAGAGGG + Intergenic
1019361222 7:605099-605121 GACATTTAGCAGAGAGCAGAAGG + Intronic
1020532353 7:9354392-9354414 GAGTATGACTAGACAGAAGACGG + Intergenic
1020859875 7:13478380-13478402 GAATTCTAGTAGAGAAAAGAGGG + Intergenic
1020863867 7:13531367-13531389 AAATATTAGTAGAGAAAAGAAGG - Intergenic
1021868560 7:24981182-24981204 GACTGTTAGTACTGAGAGGAGGG + Intronic
1021943044 7:25698526-25698548 AACCAGTAGTAGAGGGAAGAAGG + Intergenic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1027287597 7:76663785-76663807 GACAATGACTAGAGATAAGAGGG - Intergenic
1027631614 7:80613063-80613085 AAGTAGTAGTAGAGAGAGGAGGG + Intronic
1028185437 7:87779782-87779804 GACTATGAGAAGGGAGAGGAAGG - Intronic
1028722518 7:94050015-94050037 GACTATTTATTGAGAGAAGATGG - Intergenic
1030361314 7:108598108-108598130 GCCTTTTAGTTGGGAGAAGAAGG - Intergenic
1030537577 7:110788511-110788533 GAGTATAAGTAAAGAAAAGAAGG - Intronic
1030550153 7:110948419-110948441 AACCAATAGTAGAGAGAAAATGG - Intronic
1030636931 7:111960718-111960740 AACTCATAGTGGAGAGAAGAAGG - Intronic
1031429536 7:121650530-121650552 CTCTATTAGTACAGAGCAGAGGG + Intergenic
1031552475 7:123132224-123132246 TTTTATTAGTAGTGAGAAGATGG - Intronic
1033221508 7:139529464-139529486 GGCTAATAGAAGGGAGAAGAAGG + Intronic
1036526347 8:9538445-9538467 GCCTATTTGAAGAGAGAAGTGGG + Intergenic
1036717191 8:11136631-11136653 CCCTATCAGTAGAGACAAGAGGG + Intronic
1037134098 8:15441713-15441735 GAATATTATTACAGAGAACAGGG + Intronic
1038362786 8:26899179-26899201 GACTACTAGAGGTGAGAAGATGG - Intergenic
1038472413 8:27836533-27836555 GAGTAACTGTAGAGAGAAGAGGG + Intronic
1039136204 8:34325746-34325768 CACTATTATTTCAGAGAAGAAGG - Intergenic
1041491586 8:58438669-58438691 GATTATAGGTAGAAAGAAGATGG + Intronic
1041765033 8:61410557-61410579 GAATAGAAGTAGAGCGAAGAAGG - Intronic
1041824730 8:62081470-62081492 CACTATTAATAGACAGAAAAAGG - Intergenic
1042641569 8:70941115-70941137 GACTAGTAGGAGGGAGAAAAGGG - Intergenic
1043098897 8:76014436-76014458 GACTTTTAGGAGAGAGAAGAAGG - Intergenic
1043718703 8:83516284-83516306 TATTTATAGTAGAGAGAAGAAGG - Intergenic
1045370722 8:101519812-101519834 GATTATTAGCAGTGAGTAGATGG - Intronic
1046321776 8:112587665-112587687 GAGTATTAGGAGAAAAAAGAAGG - Intronic
1047637926 8:126785836-126785858 GAATATTAGTAGGTAAAAGATGG - Intergenic
1048039551 8:130712430-130712452 GACAATTAGTAGACAGTGGAAGG + Intergenic
1050785851 9:9400673-9400695 AACTATTGATTGAGAGAAGAAGG + Intronic
1051201153 9:14626146-14626168 GGTTATTAGTAGAAATAAGATGG + Intronic
1051417980 9:16862756-16862778 GAGTAGTAGAAGAGAAAAGAGGG - Intronic
1051928319 9:22354909-22354931 GTCTATTAGTATAGACAAGAAGG + Intergenic
1052092080 9:24340948-24340970 GACTAGAAGTAGAATGAAGAAGG - Intergenic
1052183951 9:25566500-25566522 GACTATTGGAGGAGAGCAGAGGG - Intergenic
1054315874 9:63585846-63585868 GACTATTACAAGAGGGAGGAAGG - Intergenic
1055018670 9:71645972-71645994 GGGTATCAGTAGAGAAAAGAAGG - Intergenic
1055726896 9:79240184-79240206 AACTTTTAGTAGAAGGAAGAAGG + Intergenic
1057965121 9:99495748-99495770 GATTTTTAGTAGAGAAAACAAGG + Intergenic
1058115817 9:101082979-101083001 GAATATCAGAAGGGAGAAGAAGG + Intronic
1058973415 9:110103530-110103552 GACTCTTTGAGGAGAGAAGAGGG + Intronic
1061886720 9:133594804-133594826 GAGGATGAGTAGCGAGAAGATGG + Intergenic
1186140783 X:6571006-6571028 GAATATTAGGAGAGAAGAGACGG - Intergenic
1186678237 X:11843377-11843399 CACTAATAGTAAAGAAAAGAGGG - Intergenic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1192868048 X:75156633-75156655 GAGTATTATGAGAGACAAGATGG - Intronic
1197307899 X:124865895-124865917 AACTATAAGAAGAGAAAAGAAGG + Intronic
1197398028 X:125951717-125951739 GACTACAAGTAGAGAGGAAACGG - Intergenic
1197413270 X:126144047-126144069 GACTATTAGCAGAGATTAAAAGG - Intergenic
1197963287 X:132029034-132029056 GACTGTTAGCTGAGAGAAGGCGG + Intergenic
1199435077 X:147804045-147804067 GACTTTTACTACAGAGAAAAAGG - Intergenic
1200439617 Y:3195365-3195387 GACAATTTGAAGAGTGAAGAGGG - Intergenic
1200875466 Y:8149905-8149927 GACTATATGTAGAGAGTTGAAGG + Intergenic
1201307103 Y:12560506-12560528 GAGTATGACTAGACAGAAGATGG + Intergenic
1201867038 Y:18667074-18667096 GATTATTTGTAGAGATTAGAGGG - Intergenic